Labshake search
Citations for Lonza :
601 - 650 of 2917 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The genotypic identity of the parasites (28) and the absence of Mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) were verified regularly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell lines were authenticated and regularly tested for Mycoplasma using the MycoAlert PLUS detection kit by Lonza (LT07-710).
-
bioRxiv - Cancer Biology 2023Quote: All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the manufacturer’s specifications.
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were authenticated by Multiplex Cell Line Authentication (MCA) and were tested for mycoplasma by MycoAlert Mycoplasma Detection Kit (Lonza). U2OS cells were transfected with the plasmids using Lipofectamine 2000 and according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lines used in this study were routinely tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (#LT07-318, Lonza), and mycoplasma-negative cells were used ...
-
bioRxiv - Neuroscience 2023Quote: ... we routinely checked cell cultures for the presence of mycoplasma using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Neuroscience 2023Quote: ... the presence of mycoplasma in the cultures was regularly screened using the MycoAlert™ Mycoplasma Detection Kit (#LT07-218, Lonza).
-
bioRxiv - Biochemistry 2023Quote: ... at 5% CO2 at 37 °C in accordance with standard mammalian tissue culture protocols and periodically tested for mycoplasma contamination via the MycoAlert Mycoplasma Detection kit (Lonza).
-
bioRxiv - Synthetic Biology 2023Quote: ... The absence of mycoplasma contamination in cell cultures was frequently validated using the MycoAlert Mycoplasma Detection Kit (Lonza, NY, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines have been regularly monitored and tested negative for mycoplasma using a mycoplasma detection kit (Lonza, LT07-218).
-
bioRxiv - Genomics 2023Quote: ... All cell lines were authenticated by short tandem repeat (STR) profiling and verified mycoplasma free using the MycoAlert PLUS Mycoplasma Detection kit (Lonza) prior to conducting experiments ...
-
bioRxiv - Immunology 2024Quote: The absence of Mycoplasma in the cell lines was routinely controlled using the MycoAlert mycoplasma detection kit (Lonza, LT07-318).
-
bioRxiv - Molecular Biology 2024Quote: ... All cell lines used are of human origin and were confirmed negative for mycoplasma before experimental use by using the MycoAlert Mycoplasma Detection Kit (Lonza) according to the the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Immunology 2022Quote: Cryopreserved PBMC (2-5 × 106/sample) were thawed in prewarmed RPMI-1640 with L-glutamine (Lonza) + 10% FCS ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 5 were isolated from human nonparenchymal liver cells (NPCs) purchased from Lonza (cat# HUCNP) as described previously (Chen et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... expanded over 5-6 days of culture in EGM-2-medium (Lonza, CC-3156, CC-4176). Medium was aspirated and replaced by pre-warmed 10 mL serum-free EGM-2-medium per 10 cm/dish ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline cell technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... Following transfection with the Amaxa Stem Cell Nucleofector Kit 2 (Lonza) using an Amaxa Nucleofector II machine ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleofection Kit V Complete Solution and Nucleofector 2 were from Lonza. Phusion Plus PCR Master Mix was from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and cultured in the appropriate media (SKBM-2 Bullet kit, Lonza, Basel ...
-
bioRxiv - Cell Biology 2024Quote: ... along with the Human Stem Cell Nucleofector™ Kit 2 (Lonza). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: Injury media solutions based on Hepatocyte Culture Medium (HCM, Lonza, CC-3198) were prepared to obtain solutions of TGF-β1 (10 ng/mL and 25 ng/mL ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... were cultured in EBM-2 supplemented with EGM-2 endothelial growth SingleQuot kit supplement & growth factors (Lonza, the Netherlands). All of the cell lines used in this study tested negative for the presence of Mycoplasma spp ...
-
bioRxiv - Developmental Biology 2020Quote: ... HLECs were grown on culture dishes or glass slide coated with 0.2% gelatin and were maintained in EGM-2 EC Growth Medium-2 Bullet Kit (Lonza). All experiments were conducted using cells until passage (P ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... Full-thickness samples were obtained by 12 mm punch and placed in 12-well plates containing 3 mL Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were tested for mycoplasma on receipt of the cell line and quarterly thereafter using the MycoAlert Mycoplasma Detection Kit according to the manufacturer’s instructions (Lonza, Basel, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... All generated THP1 and iMAC clones were tested negative for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT07-318). THP1 cells were obtained from ATCC ...
-
bioRxiv - Biophysics 2019Quote: ... Our working stock tested negative for mycoplasma contamination using the MycoAlert® Mycoplasma Detection Kit (Lonza Bioscience; Burton on Trent, UK). For experiments ...
-
bioRxiv - Genomics 2021Quote: ... Cell lines were authenticated by STR profiling and mycoplasma testing was performed using the MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza). U2OS cells were grown in DMEM supplemented with 10% tetracycline-free foetal bovine serum (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: ... All cells were routinely tested for mycoplasma contamination with MycoAlert Mycoplasma Detection Kit (Lonza, Rockland, ME, USA, Cat N° LT07-318). Chemicals and cell culture reagents were purchased from Thermo Fisher Scientific (Waltham ...
-
Rag GTPases and Phosphatidylinositol 3-Phosphate Mediate Recruitment of the AP-5/SPG11/SPG15 ComplexbioRxiv - Cell Biology 2020Quote: ... The cell lines were routinely tested for the presence of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-318, Lonza), and were also regularly treated with mycoplasma removing agent (093050044 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and all cell lines are routinely monitored for mycoplasma infection monthly using the MycoAlert Mycoplasma Detection Kit (Lonza, Cat#LT08-118). Stem cells were maintained as previously described (Spence et al. ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were negative for mycoplasma contamination and are regularly tested using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza, Rockville, MD, USA). Unless stated otherwise ...
-
bioRxiv - Biophysics 2020Quote: ... All the primary GBM cell lines were checked periodically for mycoplasma contamination using the MycoAlertTM Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All Patient-derived biological samples were collected according to a protocol approved by Italian Local Ethics Committee (CE IRST IRCCS-AVR ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines used in this study were monitored for mycoplasma infection using the MycoAlert Mycoplasma Detection Kit (Lonza TL07-218).
-
bioRxiv - Cancer Biology 2022Quote: ... Identity of cell lines was ensured by UNC’s Tissue Culture Facility with genetic signature analyses and examination of mycoplasma contamination performed using commercial detection kits (Lonza, #LT27-286).
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were found to be free of mycoplasma using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza #LT07-703).
-
bioRxiv - Immunology 2022Quote: ... Cells were maintained by twice-weekly passage and checked for mycoplasma contamination regularly using a MycoAlert mycoplasma detection kit (Lonza, UK). IAV strain A/California/04/2009 (H1N1 ...
-
bioRxiv - Microbiology 2022Quote: ... NuLi-1 cells routinely tested negative for mycoplasma infection using MycoAlert Mycoplasma Detection Kit (LT07-418, Lonza Group AG, Basel, Switzerland) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... All organoid lines were frequently tested and resulted in all cases negative in the MycoAlert mycoplasma detection kit (Lonza, LT07-318). For epithelial differentiation ...
-
bioRxiv - Cancer Biology 2023Quote: All cell lines were obtained from ATCC and were tested for mycoplasma contamination using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). HCT116 (RRID:CVCL_0291 ...
-
bioRxiv - Cancer Biology 2023Quote: ... We periodically tested all the cell lines for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza, cat. no. LT07-118). Culturing conditions were as follows ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines (and their derivatives) were confirmed to be mycoplasma-free using the MycoAlert mycoplasma detection kit (Lonza LT07- 218) at the beginning and upon completion of all experiments.
-
bioRxiv - Bioengineering 2023Quote: ... All stem cell and organoid lines were routinely monitored for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza Cat#LT07-318).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were negative for mycoplasma contamination (routinely tested for the presence of mycoplasma contamination using MycoAlert™ Mycoplasma Detection Kit (LT07-318) from Lonza Bioscience Blackley ...