Labshake search
Citations for Lonza :
551 - 600 of 1994 citations for Allopregnanolone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cell Line NucleofectorTM Kit V (Catalog #: VCA-1003) (Lonza) was used for transfection procedure according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the MycoAlert Mycoplasma Detection Kit (Lonza LT07-318).
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Cancer Biology 2021Quote: ... using buffer R (Amaxa Nucleofector Kit R VCA-1003; Lonza) and program R-001 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... contamination with the MycoAlert Mycoplasma Detection kit (Lonza LT-07). Cell lines were not authenticated.
-
bioRxiv - Neuroscience 2020Quote: The adenylate kinase assay (ToxiLightTM bioassay kit LT07-217 Lonza) to assess toxicity was performed following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Cell Biology 2019Quote: ... MCF 10A cells were cultured in the MEGM kit (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mycoplasma contamination was tested using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Neuroscience 2021Quote: ... using an Amaxa Mouse Neuron Nucleofector kit (Lonza, VPG-1001) as described previously (Wuttke et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing using the MycoAlert detection kit (Lonza, Ben OR) was performed every 2 months ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma infection monitoring was performed using MycoAlert Detection Kit (Lonza) and only mycoplasma-free cultures were used.
-
bioRxiv - Cancer Biology 2021Quote: ... based on routine testing with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Systems Biology 2023Quote: ... and Mouse Embryonic Stem Cell NucleofectorTM Kit (#VPH-1001, Lonza). Three biological replicates were performed per library on different days ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...
-
Cancer-associated fibroblasts produce matrix-bound vesicles that influence endothelial cell functionbioRxiv - Cancer Biology 2023Quote: Transient knockdown was performed using the Amaxa kit R (Lonza) and Nucleofector device (program T-20 ...
-
bioRxiv - Cell Biology 2023Quote: Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufecturer’s suggested protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and gentamicin/amphotericin (Single Quots® kit, CC‒4127, Lonza), pH 7.40 ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... With the mouse ES Cell Nucleofector Kit (Lonza VPH-1001), PiggyBAC and pBASE plasmid are co-transfected into mESCs ...