Labshake search
Citations for Lonza :
551 - 600 of 1401 citations for 7 methoxy 4 piperidin 1 ium 1 ylmethyl 3 4 dihydro 2H 1 benzoxepin 5 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1% antibiotics (10000 U/ml penicillin, 10000 µg/ml streptomycin, Lonza). The cells were incubated in a humidified atmosphere at 37°C with 5% CO2.
-
bioRxiv - Cell Biology 2022Quote: ... 1 ug PX459 plasmid and blasticidin-expressing plasmid in Amaxa buffer (Lonza) with 100 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: For USP18 KO LAPSE 1 × 106 cells were electroporated (Lonza, 4D-Nucleofactor) using the following electroporation buffers and protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 000 MNT-1 cells were transfected using nucleofection (NHEM kit, Lonza) on Amaxa device 2 (program T20 ...
-
bioRxiv - Microbiology 2023Quote: ... each 20 μL reaction contained 1X SYBR Green 1 (Lonza, Cat. # 50513), 1X Thermopol Reaction Buffer (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... the cultures were incubated with 1 mL of L7 dissociation solution (Lonza) for 2 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1 μg of sgRNA-CAS9 expression vector by 4D-Nucleofector (Lonza) using P3 Primary Cell 4D-Nucleofector X kit (Lonza) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: Cells were embedded in plugs of 1% low-melting-point agarose (Lonza) in GBSS (1.5 million to 2 million cells per plug) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 x Basal Medium Eagle Vitamins (100x stock; VWR/Lonza #733-1801), 2 mM MgSO4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... One million cells were electroporated (Nucleofector, Lonza), and after 48h ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... 50μl of blood was lysed using 500μl of ACK (Ammonium-Chloride-Potassium) Lysing Buffer (Lonza, Walkersville, USA) 10 min at room temperature ...
-
Fascin regulates protrusions and delamination to mediate invasive, collective cell migration in vivobioRxiv - Cell Biology 2019Quote: Whole-mount Drosophila ovary samples were dissected into Grace’s insect media and fixed for 10 minutes at room temperature in 4% paraformaldehyde in Grace’s insect media (Lonza, Walkersville ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were tested for Mycoplasma contamination every 4 - 6 weeks and before each experiment (Mycoalert Mycoplasma Detection kit, Lonza).
-
bioRxiv - Immunology 2022Quote: ... The solution was centrifuged at 400G for 5 minutes at 4°C and the cell pellet was resuspended in 1mL of Hank’s Balanced Salt Solution (HBSS; Lonza) containing 1% BSA (Sigma Aldrich ...
-
bioRxiv - Genetics 2020Quote: ... 20 µg ssODNs and 4 µg pSpCas9(BB)-2A-GFP construct using Human Stem Cell Nucleofector Kit 2 (Lonza). For the generation of UE-RASGEF1A-int1-KO and PIK3C2B-int10-KO hPSC lines ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: SiRNAs or overexpressing plasmids were transfected into day 4 differentiated BAT1 brown adipocytes using Amaxa Nucleofector II Electroporator (Lonza) with an Amaxa cell line nucleofector kit L according to the manufacturer’s instructions (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 4 · 105 cells were transferred into individual wells of 16-well or 96-well nucleofection cuvettes (Lonza), combined with 20 µL pre-formed RNP or nucleofector solution (no RNP control) ...
-
bioRxiv - Neuroscience 2020Quote: ... 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG, G-013 program; Lonza) before plating and maintained for 48 h.
-
bioRxiv - Immunology 2023Quote: ... 1e6 cells were then mixed with either Cas9 or base editor mRNA (4 - 4.5 µg) and nucleofected with program EO-115 using a 4D Nucleofector (Lonza). Immediately after nucleofection ...
-
bioRxiv - Immunology 2021Quote: ... Cells were differentiating for 7 days in DMEM (Lonza) supplemented with 25% of L929 medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... The embryos were then mounted in 1% low-melting agarose (Lonza; Basel, Switzerland) on a glass bottom dish (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... The squares were incubated for 1 minute with L7 hPSC passaging solution (Lonza). After aspirating the L7 solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% non-essential amino acids and 10% fetal bovine serum (Lonza, NJ, USA). The media for ER+ cell lines were further supplemented with insulin (0.1 µg/ml) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cells were treated with 1 ml of ACK RBC Lysis Buffer (Lonza) for 2 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1 mL of pre-warmed Maintenance Medium (Lonza, MCHT50) before addition of treatment media ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: ... Vector arms were gel-purified in 1% SeaPlaque agarose (Lonza, Cat No. 50105) in 1X TAE buffer.
-
bioRxiv - Physiology 2020Quote: ... and sub-cultured using 0.05% Trypsin/0.53 mM EDTA (1×) (Lonza, Nottingham, UK). Myoblasts were treated with the pharmaceutical ER stress inducer tunicamycin (0.1 μg/ml ...
-
bioRxiv - Genomics 2020Quote: ... The first consisted of 2 μl/well pmaxGFP DNA (LONZA,1 μg/ul) diluted in 250 μl/well Opti-MEM® medium (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 x 106 MLN cells were cultured in X-vivo 15 medium (Lonza) supplemented with 1% L-glutamine (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... AnnexinV reagent was added to sperm fraction diluted 1:10 in PBS (LONZA) and the solution incubated on ice for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA from supernatants and pellets were analyzed on 1% agarose (Lonza cat. # 50000) gels in TAE buffer at 3 V/cm for 40 min ...
-
bioRxiv - Immunology 2022Quote: ... supplemented as above and with 1 mM sodium pyruvate and MycoZap-PR (Lonza). Cultures were deemed established when the cells stained positive for a melanoma tumor marker (MCSP-1 Miltenyi ...
-
bioRxiv - Immunology 2022Quote: ... THP-1 cells were grown in suspension culture using RPMI-1640 media (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... Red blood cells (RBCs) were lysed with 1 mL ACK lysis buffer (Lonza) for 2 spleens at 1-2 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... 1×106 cells/mL were cultured in X-vivo 15 (Lonza, Basel, Switzerland) serum-free media supplemented with human transforming growth factor beta 1 (TGF-β1) ...
-
bioRxiv - Immunology 2024Quote: ... THP-1 human monocyte/macrophage cells (TIB20, ATCC) grown in RPMI 1640 (Lonza) + 10% FBS (S181B-500 ...
-
bioRxiv - Biophysics 2023Quote: ... BSC-1 l cell lines were tested for potential mycoplasma contamination (MycoAlert, Lonza), and all tests showed negative results ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... 4-6 µg of DNA was mixed with the resuspended cells and electroporated using the Amaxa cell nucleofector (Lonza Laboratories) program Q-001 ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.