Labshake search
Citations for Lonza :
551 - 600 of 1203 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 cells were mixed with RNPs and transferred without forming bubbles to a 16-well Nucleocuvette© Strip (Lonza, V4XP-3032). Unless otherwise stated ...
-
bioRxiv - Systems Biology 2022Quote: ... All cells were grown at 37°C in 5% CO2 and regularly checked for mycoplasma (MycoAlert mycoplasma detection kit, Lonza, Basel, Switzerland). Identity of all cell lines was confirmed by STR analysis (Leibniz Institute DSMZ GmbH ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dissociated cell suspension was cultured on rat tail collagen type I-coated dishes at 37 °C in 5% CO2 using Small Airway Epithelial Cell Growth Medium (SAGM; basal medium plus growth supplements, Lonza, CC-3118) containing 1% AA ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218).
-
bioRxiv - Cell Biology 2020Quote: ... NIH 3T3 and immortalized MVD7 cells were cultured at 37°C and 5% CO2 in high glucose DMEM culture medium (Lonza, Cologne, Germany) supplemented with 10% FBS (Biowest) ...
-
bioRxiv - Immunology 2021Quote: ... NIH AIDS Research and Reference Reagent Program) were grown at 37°C in a humidified atmosphere with 5% CO2 in RPMI 1640 medium (Lonza, Verviers, Belgium) in the case of the CEM.NKR-CCR5 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells lines were maintained in humidified 37°C the incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Cell Biology 2022Quote: ... The cells obtained were cultured in complete medium (DMEM-F12, penicillin-streptomycin, L-glutamine, nonessential aminoacids, sodium pyruvate, all Gibco, Monza, Italy and 5% FBS, Lonza, Milan, Italy). Lung adenocarcinoma A549 was purchased by ATCC and cultured in DMEM-F12 supplemented with 10% FBS (All Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were fabricated using a solution consisting of lyophilized GelMA (5 wt%) dissolved at 37°C in phosphate buffered saline (PBS; Lonza 17-516F) and combined with 0.1% w/v lithium acylphosphinate (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Genomics 2023Quote: The AIDA Data Freeze v1 gene-cell matrix (1,058,909 cells from 503 Japan, Singaporean Chinese, Singaporean Malay, Singaporean Indian, and South Korea Asian donors and 5 distinct Lonza commercial controls), with BCR-seq and TCR-seq metadata ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Systems Biology 2019Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... 1% L-glutamine (2 mM) and 1% (v/v) penicillin-streptomycin (100 IU/ml) (Lonza). Cell cultures are maintained at 37°C in a humidified atmosphere containing 5 % CO2 (v/v) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 mL of pre-warmed complete HL-1 medium (HL-1 base medium (Lonza, 344017) supplemented with 20% heat-inactivated FBS (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3D media was made up as a 1:1 mixture of SABM (Lonza, CC-3119) and DMEM (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... parasites cultured in a complete HL-1 medium (Base medium of HL-1 (Lonza, 344017) supplemented with 20% heat-inactivated FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated at 37°C in a humidified incubator with 5% CO2 and frequently tested for mycoplasma contamination using MycoAlert™ detection kit (Lonza, LT07-118).
-
bioRxiv - Cell Biology 2023Quote: ... The cells were used from passages 5-9 for the experiments and were cultured in endothelial cell growth Medium-2 (EGM™-2) Bulletkit™ (Lonza Bioscience) on pretreated tissue culture 6-well plate (VWR international) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured at 37°C with 5% CO2 and were regularly tested for mycoplasma contamination using the MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, LT07-703), and authenticated by Microsynth ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with neuronal survival factor-1 (NSF-1) (Lonza, Charles City, IA, USA, Cat# CC-4323), N2 supplement (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... the apical medium was removed and the basal medium was changed to 1:1 BEBM (Lonza) with DMEM (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SH-SY5Y dopaminergic neuroblastoma cells were cultured in Dulbecco’s modified Eagle’s medium:F-12 (DMEM:F-12; 1:1) containing high glucose (3.151 g/L) (Lonza), supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... 1 × Penicillin/Streptomycin (Lonza, 17-602E) and centrifuged to pellet ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% Penicillin-Streptomycin (Lonza, Switzerland) plus 10% FBS for primary microglia ...