Labshake search
Citations for Lonza :
551 - 600 of 652 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...
-
bioRxiv - Immunology 2022Quote: ... Cryopreserved PBMC (5 x 106/sample) were thawed in prewarmed RPMI-1640 media supplemented with L-glutamine (Lonza, Basel, Switzerland) + 10% FCS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary MEC were cultured in endothelial growth media (EGM) containing 5% FBS with growth factors (EBM-2; Lonza, Basel, Switzerland) at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase47 were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Bioengineering 2023Quote: ... Both cell lines were maintained in an incubator at 37 °C and 5% CO2 and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) regularly.
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were maintained at 37°C in 5% CO2 and frequently examined for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: NIH/3T3 fibroblasts were cultured at 37 °C and 5% CO2 in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (Lonza, Basel, Switzerland) and 1% penicillin/streptomycin antibiotic ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 and tested negative for mycoplasma contamination by MycoAlert mycoplasma detection kit (Lonza). Expression of doxycycline-inducible shRNA was induced by supplementing media with 0.1-1 µg/ml doxycycline for 6 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were maintained at 37 °C in a humidified atmosphere containing 5% carbon dioxide (CO2) and were tested for mycoplasma contamination using MycoAlert Mycoplasma detection kit (Lonza).
-
bioRxiv - Molecular Biology 2024Quote: All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza). Human primary hepatic stellate cells used for the main experiments were from Lonza (HUCLS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown at 37°C in a humidified incubator with 5% CO2 and were regularly performed mycoplasma test using a MycoAlert Mycoplasma Detection kit (Lonza). Cells with mycoplasma-free were used for experiments.
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were maintained at 37 °C in a 5% CO2 humidified atmosphere and regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza). Cell lines were cultured for no more than 20 passages following thawing ...
-
bioRxiv - Biochemistry 2024Quote: ... All cells were cultured at 37°C in 5% CO2 in humidified incubators and were free from mycoplasma (MycoAlert Detection Kit, Lonza).
-
bioRxiv - Genetics 2024Quote: ... Cells were cultured at 37°C in a humidified atmosphere and 5% CO2 in a 1:1 mixture of DMEM (Lonza) and Ham’s F10 (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: All eight guide plasmids (4 for Sun1 and 4 for Sun2) were transfected into A549 cells using the Amaxa Cell Line Nucleofector Kit T (Lonza Bioscience, VCA-1002) according to the manufacturer’s instructions and plated into a 10cm plate in A549 media ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 103 cells were plated in low-attachment 96-well plates containing 100 μL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL bFGF (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: Cell lines were cultured according to standard aseptic mammalian tissue culture protocols in 5% CO2 at 37 °C with regular testing for mycoplasma contamination using the MycoAlert™ Mycoplasma Detection Kit (Lonza). HCT 116 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37°C in 5% CO2 in either EGM-2 MV complete media (CC-3125, Lonza, Walkersville, MD) or in M199 supplemented with 20% FBS (Atlanta Biologicals ...
-
bioRxiv - Molecular Biology 2022Quote: HeLa cervical carcinoma cells were grown under a humidified 5% CO2 atmosphere at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Alpharetta, GA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Primary human lung microvascular endothelial cells (HMVEC-L) were seeded at 5000 cells/cm2 in EBM-2 with 5% FBS and EGM-2 supplement (all products, Lonza Bioscience) until reaching complete confluence 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and immortalized human Brain Microvascular Endothelial cells (HBMEC) were seeded at 5000 cells/cm2 in EBM supplemented with 5% FBS and EGM supplements (all products, Lonza Bioscience) until reaching confluence 42,43 ...
-
bioRxiv - Neuroscience 2022Quote: ... cellular ATP content was measured two-three times a week between 5-7.5 weeks post transduction using the ViaLight Plus kit (Lonza, LT07-221) or ATPlite kit (PerkinElmer ...
-
bioRxiv - Immunology 2021Quote: ... were washed in PBS/0.5%BSA and resuspended in 100 µl Nucleofector solution (Amaxa™ P3 Primary Cell 4D Nucleofector TM X Kit L, Lonza) with 4-6 µl of the appropriate siRNA (20-40 µM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-Fc stable clone was obtained by electroporation with 2×106 cells and 5 μg endotoxin-free plasmids using Amaxa kit V and program U24 with Amaxa Nucleofector 2B (Lonza, Switzerland). Electroporated cells were subsequently plated in 96-wells at 500 cells/well in Plating Medium containing 80% EX CELL® CHO Cloning Medium (Cat.no C6366 ...
-
bioRxiv - Physiology 2022Quote: ... 1 million cells were washed with PBS and electroporated with 5-10 μg of appropriate plasmid using Amaxa cell nucleofector kit T (Lonza laboratories). Cells were allowed to recover for 48 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... collected by centrifugation at 500xg for 5 min and resuspended in SF solution (SF cell line 4D-Nucleofector™ X Kit, Lonza). After addition of the RNP ...
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
Optimisation of immunocytochemistry methodology for the detection of endogenous eIF2B localised focibioRxiv - Cell Biology 2022Quote: ... Cells were maintained at 37ºC under 5% CO2 in a humidified atmosphere and routinely tested for contamination with MycoAlter™ Mycoplasma Detection Kit (Lonza, UK). Cells were validated through lineage-specific markers - anti-GFAP antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were maintained at 37°C under 5% CO2 and were routinely tested for contamination with MycoAlert™ Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2023Quote: ... Md) and cultured overnight at 37C culture at 378C with 5% CO2 in serum free HL-1 media (Lonza, Walkersville, Md) supplemented with Pen-Strep and 8 mmol/L Glutamax (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... All cells were maintained at 37°C in a 5% CO2 humidified atmosphere and were regularly screened for the presence of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, Switzerland).
-
bioRxiv - Bioengineering 2024Quote: ... were maintained in culture at 37°C and 5% CO2 atmosphere and using a growth media comprising Dulbecco’s Modified Eagle Medium (DMEM) (Lonza, Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial functionbioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 5 μg negative control or Jip4-Cas9/sgRNA complex using Cell Line Nucleofector™ Kit T (VCA-1002, Lonza) with Amaxa Biosystems Nucleofector II ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 52 years-old; non-CF donor #2: WT-AB0834, male, 71 years-old; non-CF donor #4: CC-2540S-20TL256517, Lonza, female, 48 years-old). After co-incubation with correctors for 24 h in medium (MucilAir™ medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were electroporated with either CFP-IRES or RBP-IRES-CFP vector (5 µg) using a 4D-Nucleofector (Lonza, program DS-112) in 16-well stripes (500,000 cells/well ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Systems Biology 2020Quote: Single-cell suspensions were pelleted at 400 x g for 5 min and washed once with 10 mL mammary epithelial basal medium (MEBM; Lonza CC-3151). For each sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biophysics 2021Quote: ... ATCC-CRL 10317) were grown at 37°C and 5% CO2 in Mammary Epithelial Cell Growth Basal medium (MEBM from Lonza Pharma & Biotech), supplemented with 5% Horse Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... Recovered cells were further depleted of red blood cells by resuspending cells with 5-ml of AKC lysis buffer (Lonza, Walkersville, MD). Following 5 min incubation at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... all cells were cultured at 37°C in a humidified 5% CO2 incubator in minimum essential medium Eagle α (Lonza; BE12-169F) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transduced with Adenovirus-GFP (AV-Gfp) or Adenovirus-mHilpda (AV-Hilpda) at 5 × 106 IFU/mL media in DMEM (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 cells were mixed with RNPs and transferred without forming bubbles to a 16-well Nucleocuvette© Strip (Lonza, V4XP-3032). Unless otherwise stated ...
-
bioRxiv - Systems Biology 2022Quote: ... All cells were grown at 37°C in 5% CO2 and regularly checked for mycoplasma (MycoAlert mycoplasma detection kit, Lonza, Basel, Switzerland). Identity of all cell lines was confirmed by STR analysis (Leibniz Institute DSMZ GmbH ...