Labshake search
Citations for Lonza :
5901 - 5950 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Each transfection reaction was prepared by adding 2 µl of “primed” cells resuspended in SG buffer (Lonza) to a mixture of ...
-
bioRxiv - Microbiology 2021Quote: ... connected to a Nucleofector 4D core unit (Lonza; Cat. No. AAF-1002B), and the EO100 pulse was applied to each well.
-
bioRxiv - Microbiology 2021Quote: ... The nucleofection reaction was placed in one well of a 16-well nucleofection strip (Lonza; Cat. No. V4XC-2032). The nucleofection strip was placed in the X-unit (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... and the cells were resuspended in 25 µl of SG Buffer (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Each transfection reaction was transferred to one well in 16-well nucleofection strip (Lonza; Cat. No. V4XC-2032). The nucleofection strip was placed in the X-unit (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were incubated for 4 days at 37°C in X-VIVO15 medium (Lonza) supplemented with 1% pen/strep and IL-2 at 500 U/ml prior to cell counting and infection ...
-
bioRxiv - Microbiology 2021Quote: ... Both resuspensions were mixed in a 100 μl cuvette (P3 Primary cells 4D-Nucleofector X kit L, V4XP-3024, Lonza). The programme FI-158 was used for electroporation ...
-
bioRxiv - Microbiology 2021Quote: ... and electroporated using the 4d-Nucleofector® (Lonza) and the Amaxa P3 primary cell kit with 183 pmol of crispr/tracr RNA duplex (Alt-R CRISPR-Cas9 crRNA XT and tracrRNA XT ...
-
bioRxiv - Microbiology 2021Quote: Freshly lysed Toxoplasma tachyzoites were transfected with Amaxa 4D-Nucleofector system (Lonza). ~1×106 parasites were centrifuged and resuspended in 50 μl P3 buffer ...
-
bioRxiv - Microbiology 2021Quote: ... inoculum was removed and replaced with overlay media consisting of Minimum Essential Media (MEM, Thermo # 11095080) supplemented with 0.8% SeaPlaque Agarose (Lonza # 50104), 4% FBS and 1% PSN pre-warmed to 37° ...
-
bioRxiv - Pathology 2021Quote: ... HPAECs (Human Pulmonary Artery Endothelial Cells) were purchased from Lonza. Both cells were maintained in EMG2 Endothelial Cells Growth Media (Lonza ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... used to verify viral titers were maintained in Dulbecco’s Modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 100 μg/mL penicillin and 100 μg/mL streptomycin (Lonza, Walkersville, MD) at 37°C in an atmosphere of 5% CO2 and ≥95% humidity ...
-
bioRxiv - Pathology 2021Quote: ... and 1% of Penicillin/Streptomycin (17-602E, Lonza), as described previously [32,33] ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cell lysate containing tau seeds was combined with the Tau(P301S)-YFP cells at 1.8 µg/mL and electroporation was performed on an Amaxa Nucleofactor instrument (Lonza Bioscience) using the program #Q-001 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Normal human lung fibroblasts (Lonza, Basel, Switzerland) were cultured in DMEM (high glucose ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... from Lonza; transfection agent LipoMAX ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Curcumin was incubated in either phosphate buffered saline (PBS) or cell media (DMEM/F12 Lonza supplemented with 5% fetal bovine serum ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Vero cells were plated at 2.5 x 105 cell/well in 24-well plates in Essential-modified Eagle Medium (EMEM, Lonza) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Microbiology 2021Quote: ... 100 units/ml penicillin (Lonza), 100 units/ml streptomycin (Lonza ...
-
bioRxiv - Microbiology 2021Quote: ... containing 25 mM HEPES (Lonza), 2% fetal calf serum (FCS ...
-
bioRxiv - Microbiology 2021Quote: ... 100 units/ml streptomycin (Lonza) and 2 mM L-glutamine (PAA ...
-
bioRxiv - Microbiology 2021Quote: ... Infections were carried out in Eagle’s minimum essential medium (EMEM; Lonza) containing 25 mM HEPES (Lonza) ...
-
bioRxiv - Microbiology 2021Quote: ... were gel purified and the linear fragment flanked by the small subunit rRNA (SSU) homology regions was transfected into log-phase promastigotes using an AMAXA Nucleofector 4D (Lonza). Parasites (8 × 106 cells ...
-
bioRxiv - Physiology 2021Quote: ... we injected the low-melting-point 1.9 % agarose (Lonza, USA) dissolved in extracellular solution (ECS ...
-
bioRxiv - Microbiology 2021Quote: ... Relative adenylate kinase levels were measured on 40μL of supernatants via the ToxiLightTM Non-Destructive Cytotoxicity BioAssay Kit (Lonza) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 1X SYBR Green I (Lonza), 500nM gene specific or 65nM 16S rRNA primer and 0.5 units Hot Start Taq Polymerase (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Horizontal electrophoresis of DNA was carried out using 1% Seakem LE agarose gels (Lonza, Basel, Switzerland). All cloning and molecular biology experiments were carried out according to established protocols ...
-
bioRxiv - Systems Biology 2021Quote: ... TIME cells were cultured in Endothelial Cell Growth Medium-2 BulletKitTM (EGM-2, Lonza). All cell cultures utilized in this study were maintained at 5% CO2 atmosphere and 37°C.
-
bioRxiv - Systems Biology 2021Quote: ... and routinely passaged every 4~6 days with Versene (EDTA) solution (Lonza). Selected iPSC clones were further validated for expression of pluripotency markers with immunostaining (Chen et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... 100 U/mL penicillin + 100 μg/mL streptomycin (Lonza) in matrigel–fibronectin–coated plates (44).
-
bioRxiv - Systems Biology 2021Quote: All cell lines were tested for mycoplasma (MycoAlert, Lonza) and authenticated by STR profiling (IdentiCell Molecular Diagnostics).
-
bioRxiv - Zoology 2021Quote: ... 50 μg/mL streptomycin (all from Lonza, Belgium) and with 10% of decomplemented fetal calf serum (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... NHBE cells were sourced from LONZA (Walkersville, MD) from a non-smoking patient ...
-
bioRxiv - Microbiology 2021Quote: CHO cells stably expressing recombinant RBD of SARS-CoV-2 Spike (aa. 319-591) (GenBank accession no. AAP13567.1) were propagated in ProCho5 media (Lonza) containing glutamine ...
-
bioRxiv - Microbiology 2021Quote: ... and suspension adapted in PROCHO5 medium (Lonza, Walkersville, MD, USA) with 1 % FBS in shaker flasks (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... Transfection was carried out using program X-001 of the Amaxa Nucleofector IIb (Lonza) electroporator in 2 mm gap cuvettes ...
-
bioRxiv - Microbiology 2021Quote: ... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells) dilutions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Viral supernatants were collected 3 and 6 days post-infection and induced-cell death and viral titers were determined in the ToxiLight Bioassay (Lonza) and PFA ...
-
bioRxiv - Microbiology 2021Quote: ToxiLight® BioAssay (Lonza) was used to measure the AK activity in culture supernatants as a marker of cell death ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary human hepatocytes (huHEP) (Lonza, Swizerland) and isolated murine hepatocytes (muHEP ...
-
bioRxiv - Molecular Biology 2021Quote: ... HuHEP were seeded in supplemented hepatocyte plating medium (HPM) (#MP100, Lonza, Swizerland) at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... was assessed in primary human hepatocytes (Lonza, Swizerland) cultivated in collagen type I (10 µg cm−1 ...
-
bioRxiv - Molecular Biology 2021Quote: Transporter-qualified human hepatocytes from different donors were purchased from Lonza. Hepatocytes were seeded collagen-coated in 96 well plates using HPM and HMM as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... After 1 h the medium was carefully replaces with supplemented hepatocyte maintenance medium (HMM) (#MP250, Lonza, Swizerland) until stimulations ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEP and NPC were purchased from Lonza, Swizerland ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024, Lonza). Nucleofected cells were seeded in Matrigel matrix-coated (1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Molecular Biology 2021Quote: ... (Lonza, Switzerland # BE12-707F) supplemented with 10 % FBS (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... cultivated in EGM-2 Medium (Lonza), and used after 1–3 passages ...