Labshake search
Citations for Lonza :
501 - 550 of 732 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Individual nuclei of G1 cells were sorted directly into 5 μL freezing buffer (50% PBS, 7.5% DMSO, and 42.5% 2X ProFreeze-CDM [Lonza]) in 96-well plates using a FACSJazz cell sorter (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and maintained in Roswell Park Memorial Institute (RPMI) 1640 Medium by adding 5% fetal bovine serum (FBS, Lonza), 2 mM L-glutamine ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Immunology 2023Quote: ... and nucleofected with 5 μg of a plasmid using program X-001 in the Nucleofector IIb device (Lonza) according to the manufacturer’s procedure ...
-
bioRxiv - Immunology 2023Quote: ... The MPRA vector library was nucleofected into TPP macrophages (5µg vector into 5×106 cells) in 100μl nucleofection buffer (Human Macrophage Nucleofection Kit, Lonza) using a Nucleofector 2b (program Y-011) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: Human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were stored in humidified incubators at 37 °C with 5% CO2 and routinely checked for mycoplasma (Lonza).
-
bioRxiv - Molecular Biology 2022Quote: ... 15 μg Tir1 targeting vector and 5 µg of pX330-EN1201) and transferred to a single Nucleocuvette (Lonza). Nucleofection was performed using the protocol CG110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... kept with males and fed with yeast paste (n=5) were dissected in Schneider’s media (Lonza; LZ04-351Q) containing 200 μg/mL insulin (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cells were harvested by centrifugation at 1,250g for 5 minutes and resuspended in 25 µL SF buffer (Lonza) to a final concentration of 2E6 cells/µL ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-sense RNA probe against Gdnf exons was transcribed and hybridized on thick sections derived from P4 kidneys embedded in 4% low melting agarose (NuSieve GTG, Lonza). BM purple was used for colorimetric reaction.
-
bioRxiv - Immunology 2021Quote: ... suspension CHO cells expressing wildtype human CTLA-4 were plated at 1 × 106 cells/well in DPBS (Lonza, Basel, Switzerland) containing 0.5% BSA (MilliporeSigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 μg of linearized plasmid containing wild-type or Ku70 3A cDNA was transfected using Amaxa nucleofector solution V (Lonza) and program T-020 ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of eGFP-Centrin1 was achieved by electroporating 4.106 B lymphoma cells with 4 μg of plasmid using the Amaxa Cell Line Nucleofector Kit R (T-016 program, Lonza). Cells were cultured in CLICK medium for 5 to 16 h before imaging.
-
bioRxiv - Biochemistry 2022Quote: ... and 18-36 μl ribonucleoprotein complexes were added along with 4 μM Alt-R Cas9 electroporation enhancer (IDT) to a nucleofection chamber (Lonza). Cells were electroporated using the nucleofector program EN-138 and gently resuspended in DMEM ...
-
bioRxiv - Biophysics 2022Quote: ... 4-6 µg of DNA was mixed with the resuspended cells and electroporated using the Amaxa cell nucleofector (Lonza Laboratories) program Q-001 ...
-
bioRxiv - Cell Biology 2021Quote: ... or mutant) plasmids (4µg) were introduced to 4×106 dissociated neurons using Amaxa rat nucleofector kit (Lonza Bioscience, VPG-1003). Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells ...
-
bioRxiv - Microbiology 2020Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell line authenticity was confirmed by STR genotyping (July 2019) and mycoplasma testing was performed every 4-6 weeks (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Cell Biology 2021Quote: ... was generated by the introduction of a plasmid carrying the EGFP gene under the control of the CAG promoter to EStTA5-4 cells using the Amaxa Mouse ES cells Nucleofector Kit (VPH-1001, Lonza).
-
bioRxiv - Microbiology 2021Quote: ... Tightly synchronized schizonts were transfected using the Amaxa 4-D electroporator and P3 Primary Cell 4D Nucleofector X Kit L (Lonza) according to the protocol described by Moon et al ...
-
bioRxiv - Immunology 2020Quote: ... Cells were mixed with 5 μl of the RNP mixture by gently pipetting and were transferred to pre-cooled (4 °C) 16 well Nucleocuvette Strips (Lonza). Primary human B cells were nucleofected using the EH100 program of Lonza’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blots were conducted by running equivalent amounts of protein on 4-20% Tris-Glycine SDS/polyacrylamide gradient gels (Lonza) after reduction with 2-mercaptoethanol and heating to 95°C for 5m ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Immunology 2024Quote: ... A volume of 20 μL of cells was then transferred to the Nucleocuvette stripwell and electroporated with program DN-100 on a 4-D Nucleofector X unit (Lonza). Immediately after nucleofection ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 µL of cell suspension was then gently mixed with each crRNP and aliquoted into a 96-well electroporation cuvette for nucleofection with the 4-D Nucleofector X-Unit (Lonza) using pulse code EO-120 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
Synchronous 3D patterning of diverse CNS progenitors generates motor neurons of broad axial identitybioRxiv - Neuroscience 2024Quote: ... For the generation the ISL1 reporter line cells were nucleofected with pTG-Cr-ISL1 and pTG-HR-ISL1-p2A-mNeonGreen plasmids using a 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... The mixture was transferred to a confocal plate and subsequently UV crosslinked at 15 mW/cm2 for 1 minute and cultured for 4 days in EGM-2 media (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Genomics 2021Quote: The MPRA libraries were electroporated in 4 to 6 million cells each using the Nucleofector 2b or 4D (Lonza, Basel, Switzerland) with 6 µg of plasmid DNA and program T-030 or Y-001 and DS-132 ...
-
bioRxiv - Physiology 2022Quote: ... 5 million cells were washed with phosphate buffered saline (PBS) and electroporated with 4-6 μg of appropriate plasmid construct using an Amaxa cell nucleofector (Lonza laboratories) and nucleofection reagent (362.88 mM ATP-disodium salt ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were grown under sterile conditions for no longer than 4 weeks after thawing and were frequently tested for Mycoplasma using the MycoAlert® Assay kit (Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... DCs derived from progenitor cells were transfected with 4 μg of DNA using the nucleofector kit for primary T cells (Amaxa, Lonza Group) following the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Isolated NK cells were activated at 1 x 106 cells mL-1 for 5 days in XVivo15 medium (Lonza) with 5% fetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary XP-C patient fibroblasts XP168LV were cultured at 37°C in an atmosphere of 5% CO2 in Ham’s F10 medium without thymidine (Lonza) supplemented with 20% fetal calf serum and antibiotics.