Labshake search
Citations for Lonza :
451 - 500 of 1006 citations for Recombinant Human TNFRSF4 Fc His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: Human umbilical vein endothelial cells (HUVEC) were purchased from Lonza and cultured in endothelial media (VascuLife ...
-
bioRxiv - Cancer Biology 2024Quote: Primary human umbilical vein endothelial cells (HUVEC; Lonza, Basel, Switzerland) were cultured in Endothelial Cell Growth Medium-2 BulletKit (EGM-2 ...
-
bioRxiv - Cancer Biology 2024Quote: Primary human umbilical vein endothelial cells (HUVECs; Lonza, Basel, Switzerland) were cultured in Endothelial Cell Growth Medium-2 BulletKit (EGM-2 ...
-
bioRxiv - Microbiology 2022Quote: ... normal human bronchial epithelial cells (NHBEs, Cat# CC-2540, Lonza) were used to generate AOs ...
-
bioRxiv - Pathology 2022Quote: ... or primary asthmatic human bronchial ASMC (Lonza, Walkerville,MD, USA) using an RNAeasy mini kit (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... Human PBMCs were cultured in X-VIVOTM 15 media (Lonza) supplied with 5 % human AB serum (MP Biomedical ...
-
bioRxiv - Cell Biology 2023Quote: ... Human coronary artery endothelial cells (HCAECs) were purchased from Lonza Clonetics (Walkersville ...
-
bioRxiv - Bioengineering 2023Quote: The hBMSCs were isolated from human bone marrow (Lonza, USA) and characterized as previously described [21] ...
-
bioRxiv - Microbiology 2022Quote: ... normal human bronchial epithelial cells (NHBEs, Cat# CC-2540, Lonza) were used to generate AOs ...
-
bioRxiv - Bioengineering 2023Quote: Human umbilical vein endothelial cells (HUVEC) were purchased from Lonza and cultured in endothelial media (VascuLife ...
-
bioRxiv - Physiology 2023Quote: ... Cryopreserved human aortic smooth muscle cells were obtained from Lonza Pharma and Biotech (Catalog # ...
-
bioRxiv - Physiology 2023Quote: ... HEK293T cells and Human subcutaneous preadipocytes (Lonza Catalog #: PT-5020) were used for all cell culture-related experiments ...
-
bioRxiv - Immunology 2023Quote: ... human Epidermal Growth Factor (CC-4230D) (all purchased from Lonza) in a T25 flask (Lonza ...
-
bioRxiv - Immunology 2023Quote: A healthy human bronchial smooth muscle cell line (BSMC, Lonza) was cultured in Smooth Muscle Growth Medium (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human lung FBs were obtained from Lonza (#CC-2512) and cultured in Fibrolife Fibroblast Medium (#LL-0011 ...
-
bioRxiv - Bioengineering 2023Quote: ... Normal human dermal fibroblasts (NHDFs; Lonza; passages 4 to 10) were cultured on dishes in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Biophysics 2023Quote: ... Primary human umbilical vein endothelial cells (HUVEC; Lonza, Basel, Switzerland) were cultured in Endothelial Cell Growth Medium-2 BulletKit (EGM-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGM-2 and normal human lung fibroblasts (NHLF, CC2512, Lonza) at a concentration of 2×105 cells/ml was added to each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human umbilical vein endothelial cells (HUVECs, Lonza, Allendale, NJ, USA) were cultured in EGM-2 (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: Normal human bronchial epithelial cells (NHBE) were used from Lonza Walkersville ...
-
bioRxiv - Developmental Biology 2023Quote: Human umbilical vein endothelial cells (HUVEC) were obtained from Lonza and cultured in EGM-2 cell culture medium (Lonza) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human visceral pre-adipocytes were purchased from Lonza (PT-5005) and cultured according to the manufacturer’s instructions in PGM-2TM Preadipocyte Growth Medium-2 BulletKitTM from Lonza (PT-8002) ...
-
bioRxiv - Bioengineering 2023Quote: ... and Amaxa Human CD34+ Cell Nucleofector kit (Lonza, Basel, Switzerland) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... normal human bronchial epithelial cells (NHBEs, Cat# CC-2540, Lonza) were used to generate AOs ...
-
bioRxiv - Bioengineering 2023Quote: Normal human lung fibroblast (NHLF) cell line (Lonza, CC-2512) was used to study the cytotoxicity of the C-TETHT and C-TETHP ...
-
bioRxiv - Bioengineering 2023Quote: Normal Human Bronchial Epithelial (NHBE) cells were obtained from Lonza and differentiated according to the protocol provided by StemCell Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Human CD34+ HPCs isolated from full-term cord blood (Lonza) or adult bone marrow (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: ... and human mesenchymal stem cells (hMSC, Lonza, cat. PT-2501) were purchased from Lonza (Walkersville ...
-
bioRxiv - Molecular Biology 2024Quote: ... human HSCs were detached and resuspended in P3 buffer (Lonza, P3 primary cell 384-well nucleofector kit ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein ECs (HUVECs, passage 4-6, pooled, Lonza) were cultured in EC growth medium-2 (EGM™-2 Bulletkit™ ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Umbilical Vein Endothelial Cells (HUVEC) were purchased from Lonza (Walkersville ...
-
bioRxiv - Molecular Biology 2020Quote: Cryopreserved normal human bronchial epithelial (NHBE) cells were obtained from Lonza. The undifferentiated cells were seeded on collagen IV-coated transwell plates (Corning Costar ...
-
bioRxiv - Bioengineering 2022Quote: ... The Human Peripheral Blood CD4+ T cells were purchased from Lonza Group Inc ...
-
bioRxiv - Immunology 2021Quote: ... Normal primary human keratinocytes were purchased from Lonza (Morristown, NJ, USA) and cultured in Lonza KGM-gold keratinocyte growth medium according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Primary normal human astrocytes (NHAs) were purchased from Lonza (#CC-2565). Immortalized human oligodendrocyte MO3.13 cells were a kind gift from Dr ...
-
bioRxiv - Immunology 2020Quote: Human fetal astrocytes cell lines were purchased from Lonza (CC-2565) and Thermo Fisher Scientific (N7805100 ...
-
bioRxiv - Cell Biology 2019Quote: ... and human pulmonary artery smooth muscle cells (HPASMCs, Lonza, CC-2581) were cultured in endothelial cell growth medium 2 (ECGM2 ...
-
bioRxiv - Physiology 2020Quote: ... and human pulmonary artery smooth muscle cells (HPASMCs, Lonza, CC-2581) in smooth muscle cell growth medium 2 (SMCGM2 ...
-
Anisotropic Rod-Shaped Particles Influence Injectable Granular Hydrogel Properties and Cell InvasionbioRxiv - Bioengineering 2021Quote: Multicellular spheroids consisting of human umbilical vein endothelial cells (HUVECs; Lonza) and human mesenchymal stromal cells (MSCs ...
-
bioRxiv - Cancer Biology 2020Quote: Normal human lung fibroblasts (NHLFs) were obtained from Lonza (Basel, Switzerland), and endothelial colony forming cell-derived endothelial cells (ECFC-ECs ...
-
bioRxiv - Microbiology 2020Quote: ... Normal human bronchial epithelial (NHBE) cells (Lonza, CC-2540 Lot# 580580) were isolated from a 79-year-old Caucasian female and were maintained in bronchial epithelial growth media (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: Transporter-qualified human hepatocytes from different donors were purchased from Lonza. Hepatocytes were seeded collagen-coated in 96 well plates using HPM and HMM as described above ...
-
bioRxiv - Microbiology 2020Quote: ... Normal human bronchial epithelial (NHBE) cells (Lonza, CC-2540 Lot# 580580) were isolated from a 79-year-old Caucasian female and were maintained in bronchial epithelial growth media (Lonza ...
-
bioRxiv - Microbiology 2019Quote: Primary Human Umbilical Vein Endothelial cells (HUVECs) were purchased from Lonza and were maintained in Endothelial Basal Medium (EBM ...
-
bioRxiv - Cell Biology 2020Quote: Human umbilical vein endothelial cells (HUVECs) were from Lonza (Allendale, NJ) and were cultured in in EGM-2 (Lonza ...