Labshake search
Citations for Lonza :
451 - 500 of 973 citations for Recombinant Human Metadherin GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Human cardiac microvascular endothelial cells (HVECs) were purchased from Lonza and were immortalized through transfection of SV40-T-antigen (MiliporeSigma) ...
-
bioRxiv - Bioengineering 2024Quote: Normal human dermal fibroblast (NHDF) cells were purchased from Lonza, Germany ...
-
bioRxiv - Developmental Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were obtained from Lonza Bioscience (# C2519A ...
-
bioRxiv - Bioengineering 2024Quote: ... and human primary lung microvascular endothelial cells (CC-2527, Lonza; obtained at passage 3 and expanded according to passage 5 before use ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human primary skeletal muscle myoblasts (Lonza, HSKMM, Cat# CC-2580) were cultured according to the supplier’s protocols.
-
bioRxiv - Cell Biology 2024Quote: Primary human dermal and lung fibroblasts were obtained from Lonza and cultured in DMEM Glutamax (31966-021 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human mesenchymal stem cells (MSCs; Lonza, PT-2501; Lot 23TL142784) were cultured in MSCGM (Lonza ...
-
bioRxiv - Cancer Biology 2024Quote: ... and human mesenchymal stem cells (hMSC, Lonza, cat. PT-2501) were purchased from Lonza (Walkersville ...
-
bioRxiv - Developmental Biology 2024Quote: ... or human stem cell Nucleofector I kit (Lonza VPH-5012). For selection ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human umbilical vein endothelial cells (HUVECs) were purchased from Lonza and were grown in Supermedia as described (Koh et al ...
-
bioRxiv - Developmental Biology 2024Quote: Human pulmonary artery endothelial cells (HPAECs) were purchased from Lonza Bioscience and were cultured in Endothelial Growth Medium-2 (cc-3162 ...
-
bioRxiv - Cell Biology 2024Quote: ... Human umbilical vein endothelial cells (HUVECs) were obtained from Lonza, located in Basel Stücki ...
-
bioRxiv - Bioengineering 2023Quote: ... gRNAs were complexed with recombinant Cas9 (IDT Cat#1081059) and introduced into cells by electroporation (4D-Nucleofector, Lonza Biosciences) according to manufacturer protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Neuroscience 2024Quote: ... along with 20 μg recombinant Cas9 (IDT) and 1 pmol of each bridging oligonucleotide using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) using the CA-137 program34 ...
-
bioRxiv - Neuroscience 2024Quote: ... 500 pmol Cas12 crRNA (GGAAAAGTAAAAGATGTCTGAAT, IDT) and 20 μg recombinant Cas12 (IDT) using the P3 Primary Cell 4-D-Nucleofector kit (Lonza) and 4D-Nucleofector X unit (Lonza ...
-
bioRxiv - Biochemistry 2024Quote: ... and the manufacturer’s instructions were followed (PyroGene Recombinant Factor C Endpoint Fluorescent Assay-#50-658U, Lonza Bioscience, Walkersville, MD, USA). Serum samples were diluted at 1:50 for LBP analysis ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Umbilical Vein Endothelial Cells (HUVEC) were purchased from Lonza (Walkersville ...
-
bioRxiv - Molecular Biology 2020Quote: Cryopreserved normal human bronchial epithelial (NHBE) cells were obtained from Lonza. The undifferentiated cells were seeded on collagen IV-coated transwell plates (Corning Costar ...
-
bioRxiv - Bioengineering 2022Quote: ... The Human Peripheral Blood CD4+ T cells were purchased from Lonza Group Inc ...
-
bioRxiv - Immunology 2021Quote: ... Normal primary human keratinocytes were purchased from Lonza (Morristown, NJ, USA) and cultured in Lonza KGM-gold keratinocyte growth medium according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Human fetal astrocytes cell lines were purchased from Lonza (CC-2565) and Thermo Fisher Scientific (N7805100 ...
-
bioRxiv - Physiology 2020Quote: ... and human pulmonary artery smooth muscle cells (HPASMCs, Lonza, CC-2581) in smooth muscle cell growth medium 2 (SMCGM2 ...
-
Anisotropic Rod-Shaped Particles Influence Injectable Granular Hydrogel Properties and Cell InvasionbioRxiv - Bioengineering 2021Quote: Multicellular spheroids consisting of human umbilical vein endothelial cells (HUVECs; Lonza) and human mesenchymal stromal cells (MSCs ...
-
bioRxiv - Cancer Biology 2020Quote: Normal human lung fibroblasts (NHLFs) were obtained from Lonza (Basel, Switzerland), and endothelial colony forming cell-derived endothelial cells (ECFC-ECs ...
-
bioRxiv - Microbiology 2020Quote: ... Normal human bronchial epithelial (NHBE) cells (Lonza, CC-2540 Lot# 580580) were isolated from a 79-year-old Caucasian female and were maintained in bronchial epithelial growth media (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: Transporter-qualified human hepatocytes from different donors were purchased from Lonza. Hepatocytes were seeded collagen-coated in 96 well plates using HPM and HMM as described above ...
-
bioRxiv - Microbiology 2020Quote: ... Normal human bronchial epithelial (NHBE) cells (Lonza, CC-2540 Lot# 580580) were isolated from a 79-year-old Caucasian female and were maintained in bronchial epithelial growth media (Lonza ...
-
bioRxiv - Cell Biology 2020Quote: Human umbilical vein endothelial cells (HUVECs) were from Lonza (Allendale, NJ) and were cultured in in EGM-2 (Lonza ...
-
bioRxiv - Cancer Biology 2021Quote: ... Two hundred microliters of human microvascular endothelial cells suspension (Lonza, Basel) (6.25×105 cells/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... Normal human primary lung fibroblasts were obtained from Lonza (Basel, Switzerland) and were cultured in fibroblast growth basal medium ...
-
bioRxiv - Bioengineering 2022Quote: MSCs were isolated from human bone marrow (Lonza, Walkersville, MD, USA) and characterized for surface markers and multilineage differentiation ...
-
bioRxiv - Bioengineering 2022Quote: Human dermal lymphatic microvascular endothelial cells (CC-2543, HDLMEC, Lonza, USA) were cultured in Vasculife Endothelial Medium (Lifeline ...
-
bioRxiv - Immunology 2022Quote: MSCs were isolated from human bone marrow (Lonza, Walkersville, MD, USA) and characterized for surface markers and multilineage differentiation ...
-
bioRxiv - Bioengineering 2022Quote: ... Human bone marrow was commercially purchased from Lonza (Walkersville, MD, USA), collected under their institutional guidelines and with written informed consent ...
-
bioRxiv - Bioengineering 2022Quote: The vasculogenic microgels were seeded with human lung fibroblasts (FB, Lonza) from a 29-year-old male donor and human umbilical vein endothelial cells (EC ...
-
bioRxiv - Cell Biology 2020Quote: ... control-MPC and human myoblast in EGM-2V basal medium (Lonza). After 16 h ...
-
bioRxiv - Bioengineering 2021Quote: Human bone marrow-derived mesenchymal stem cells (MSCs) (Lonza, Walkersville, MD) were cultured in DMEM supplemented with 10% MSC-qualified fetal bovine serum (FBS ...
-
bioRxiv - Physiology 2021Quote: ... Primary normal human bronchial (HBE) cells were from Lonza (Walkerville, MD) cultured in PneumaCult (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2021Quote: Primary human hepatocytes were obtained from Lonza (Cat#HUCPG, Lot#HUM4252) and were thawed according to the manufacturer’s instructions into William’s E Medium (without phenol red ...
-
bioRxiv - Neuroscience 2021Quote: ... iPSCs were transfected with the Human Stem Cell Nucleofector Kit (Lonza) with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: Primary Human Hepatocytes (PHH) were obtained from LONZA (Walkersville, Maryland, USA) and Human Stellate Cells (HSC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary human astrocytes (sex unknown) were purchased from Lonza (CC-2565) and cultured in ABM Basal Medium (Lonza CC-3187 ...
-
bioRxiv - Biophysics 2021Quote: ... Primary human lung microvascular endothelial cells (HMVEC) were purchased from Lonza,cultured using Vascular Cell Basal Medium (ATCC® PCS-100-030) ...
-
bioRxiv - Developmental Biology 2021Quote: Human iPSCs were generated using the electroporation (4D-Nucleofector System, Lonza) of fibroblasts with episomal vectors ...
-
bioRxiv - Immunology 2021Quote: Pooled human umbilical cord vein endothelial cells (HUVECs, Lonza, Basal, Switzerland) were cultured using endothelial growth media (EGM-2 ...
-
bioRxiv - Cell Biology 2021Quote: Human umbilical vein endothelial cells (HUVECs) were from Lonza (Allendale, NJ) and were cultured in in EGM-2 (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: Human umbilical vein endothelial cells from pooled donors (HUVEC; #C2519AS; Lonza) were thawed from liquid nitrogen and resuspended in Complete Human Endothelial Cell medium (#H116 ...
-
bioRxiv - Bioengineering 2022Quote: hBMSCs were isolated from human bone marrow (Lonza, Walkersville, MD, USA) and characterized for surface markers and multilineage differentiation ...
-
bioRxiv - Bioengineering 2022Quote: ... ~1 × 105 human dermal microvascular endothelial cells (HDMECs, Lonza, CC-2543) were seeded into ~ 150 μm diameter channels in a 7 mg mL-1 type I collagen matrix (Corning ...