Labshake search
Citations for Lonza :
451 - 500 of 551 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cells obtained were cultured in complete medium (DMEM-F12, penicillin-streptomycin, L-glutamine, nonessential aminoacids, sodium pyruvate, all Gibco, Monza, Italy and 5% FBS, Lonza, Milan, Italy). Lung adenocarcinoma A549 was purchased by ATCC and cultured in DMEM-F12 supplemented with 10% FBS (All Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... CRISPR-CAS9 knockout in SU-DIPGXIII cells was performed using the Amaxa P3 Primary Cell 4D-Nucleofector X Kit L (Lonza, V4XP-3012). First ...
-
bioRxiv - Cell Biology 2023Quote: PMOs were dissolved in distilled water and transfected into RD cells using the Amaxa Cell Line Nucleofector Kit L and a Nucleofector II electroporation device (Lonza, Basel, Switzerland) with program T-030 or into cells from a DMD patient without a transfection reagent.
-
bioRxiv - Immunology 2023Quote: ... 80 µl of supernatant was removed and replenished with 100 µl IMDM/Glutamax/ 10% FBS containing 2× MycoZap Plus-PR (Lonza #VZA-2021), 100 ng/ml human IL-2 (GoldBio #1110-02-50) ...
-
bioRxiv - Molecular Biology 2019Quote: ... a modified antisense or control oligonucleotide (1 μM) was transfected into 3 × 106 cells using Nucleofector technology (Lonza) 16–18 h before the assay ...
-
bioRxiv - Biochemistry 2021Quote: ∼300 pairs of ovaries per replicate were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell lines were tested for mycoplasma every 3 months using MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland). All cells used were <20 passages from thaw.
-
bioRxiv - Immunology 2021Quote: ... and suspended at a concentration of 3 × 106cells/mL in RPMI-1640 (BioWhittaker®, Lonza, Walkersville, MD, USA) containing 15% heat-inactivated horse serum ...
-
bioRxiv - Molecular Biology 2021Quote: Inguinal white adipose tissue from 3-4 WT-C57Bl/6 male mice was collected and placed in Dulbecco’s modified eagle’s medium (DMEM; Lonza) supplemented with 1% Penicillin/Streptomycin (PS ...
-
bioRxiv - Microbiology 2021Quote: ... The human lung epithelial cell line Calu-3 (ATCC HTB-55) was maintained in DMEM F-12 (Lonza) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
bioRxiv - Cell Biology 2023Quote: Bone marrow derived DCs at day 7 (3×106) were transfected with 100μl of the Amaxa solution (Lonza) containing siRNA (control or target-specific ...
-
bioRxiv - Immunology 2023Quote: ... beads were removed on day 3 followed by electroporation using the Human T Cell Nucleofector™ Kit (Lonza) and the Amaxa Nucleofactor® 2b (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: For immunoprecipitations performed on THP-1 cells were first transfected with 2 μg of empty vector pCDNA 3.1 or plasmid containing 3x FLAG_Vamp-3 using the Amaxa 4D nucleoporator system (Lonza) with the Amaxa SG Cell line kit and program FF-100 and following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... All cell lines were cultured less than 3 months after resuscitation and tested for contaminants using MycoAlert (Lonza) every 1-3 months to ensure they were free of Mycoplasma contamination.
-
bioRxiv - Biochemistry 2024Quote: ... 3×105 cells were electroporated using P3 Primary Cell Nucleofector® 4D Kit and Nucleofector 4D system (Lonza) with 400 ng donor DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and CT-26 (ATCC #CRL-2638) 4T1 cells were cultured in DMEM or RPMI 1640 with L-Glutamine (Lonza™ BioWhittaker™ # BW12115F12) supplemented with 10% of FBS ...
-
bioRxiv - Immunology 2020Quote: 3T3 cells were transfected with either hACE2 or GFP mRNA using an Amaxa cell line nucleofector L kit (Lonza; catalog number VCA-1005) according to the manufacturer’s instructions ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: SQD9 cells were transfected with PX459 using Nucleofector™ 2b Device and Cell Line Nucleofector™ Kit L (Lonza, #AAB-1001, #VACA-1005). Cas9-expressing cells were selected with 0.625 µg/mL puromycin (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: Electroporation of multiplex CRISPR-Cas9 pX330 plasmids into normal bronchial epithelial cells was achieved using the P3 Primary Cell 4D-Nucleofector® X Kit L (Lonza, V4XP-3024) and 4D-Nucleofector™ X Unit (Lonza) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3.0 × 106 cells were electroporated using the P3 Primary Cell 4D-Nucleofector L kit and 4D-Nucleofector system (Lonza Group Ltd., Basel, Switzerland), following the manufacturer’s protocol (1320v ...
-
bioRxiv - Immunology 2024Quote: ... were incubated with sgRNA and CAS9 protein complex and electroporation was done using P3 Primary Cell 4D-NucleofectorTM X Kit L (Lonza, cat # V4XP-3024) and Lonza 4D nucleofector system ...
-
bioRxiv - Cancer Biology 2019Quote: ... NSCs were harvested with Accutase and 2-3×106 cells were resuspended in 100µl mouse neural stem cell nucleofector buffer (Lonza) with 2µg plasmid DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 106 cells were co-transfected with 5 μg of pSpCas9(BB)– 2A–Puro:sgRNA #4 plasmid and 5 μg of pCSII–CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid using the Amaxa Nucleofector (Lonza) with nucleofection solution R ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA directed against Dsg1 (Integrated DNA Technologies) with a targeting sequence 5′-CCATTAGAGAGTGGCAATAGGATGA-3′ using Amaxa Nucleofector System (Lonza) for electroporation of cells according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µL of the sgRNA (total 300 pmol) was added to 12 µL of SE buffer (Lonza V4XC-1032). In another well ...
-
bioRxiv - Biochemistry 2021Quote: ... For each nucleofection 3 x 106 cells were resuspended in 80 μl of mouse ES cell nucleofection solution (Lonza). Equimolar (0.32 nmol ...
-
bioRxiv - Bioengineering 2019Quote: K562 cells were transfected with two gRNAs targeting exon 1 and 3 of NGLY1 and Cas9 plasmid (lentiCas9-Blast) by Nucleofection according to the manufacturer’s protocol (Nucleofector, Lonza). LentiGuide-Puro (Addgene plasmid #52963 ...
-
bioRxiv - Cancer Biology 2020Quote: ... were used in passages 3-6 and cultured on 0.1% gelatin-coated tissue culture plates in complete EGM2 (Lonza) supplemented to a total of 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Immunology 2019Quote: ... washed once in PBS and resuspended in Mouse B cell Nucleofector Solution with Supplement (murine B cells) or Primary Cell Nucleofector Solution 3 with Supplement (human B cells) prepared to the manufacturer’s instructions (Lonza) at a concentration of 4 - 5 × 106 cells / 86 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... HESCs were transfected with a total of 4ug DNA in a ratio 2:3 (gRNAs:donor template) using the Amaxa P3 Primary Cell 4D-Nucleofector Kit (Lonza). Puromycin was added 3 days after electroporation at a concentration of 0.5ug/ml ...
-
bioRxiv - Genetics 2019Quote: The transfection of the HBMEC cells was carried out according to the same protocol but with 3 μg DNA for 0.5×106 cells in 100 μl cells of Cell Line Nucleofector Solution V (Lonza) with the program U-015 ...
-
bioRxiv - Cell Biology 2022Quote: Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and (iv) the NDF-2 and NDF-3 cell lines (human neonatal dermal fibroblast cell lines, #CC-2509; Lonza Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... and SK-BR-3 cells (Korean Cell Line Bank, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Lonza, Switzerland) supplemented with 10 % (v/v ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: A total of 3-4µg of plasmid DNA was electroporated into 3-4x106 early passage ES cells using the Amaxa Nucleofector II (Lonza) programme A-023 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma contamination was conducted every 3-4 weeks using the MycoAlert PLUS mycoplasma detection kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: Normal human bronchial epithelial cells (HBECs) from 3 independent donors (Supplemental Table S1) were obtained from Lonza (CC-2540) and cultured in BEGM growth media (Lonza CC-3170) ...
-
bioRxiv - Biophysics 2023Quote: ... DNA samples were also analyzed by electrophoresis through 1.5 % and 3 % agarose gels (Seakem LE agarose, Lonza, Rockland, ME) in TAE (Tris-acetate + 1 mM EDTA ...
-
bioRxiv - Genetics 2024Quote: ... Approximately 2.5×105 CD34+ HSPCs were mixed with gRNA:Cas9 complexes and 3 µg ssDNA donor template (20 μL) in nucleofector strip format (Lonza). Electroporation was performed in Unit X ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Microbiology 2023Quote: Embryonic monkey kidney cells (MA104) were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 4.5 g/L glucose (Lonza 12-640F or Corning 15-107-CV), 1% penicillin-streptomycin [Corning]) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4T1 (ATCC #CRL-2539) and E0771 (CH3 Biosystems #940001) cell lines were culture in RPMI 1640 with L-Glutamine (Lonza™ BioWhittaker™ # BW12115F12) supplemented with 10% of FBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... counted and 1×106 cells electroporated using the CB-150 program of the 4D-Nucleofector™ System and the P3 Primary Cell 4D-Nucleofector® X Kit L (Lonza, #V4XP-3024) according the manufactures protocol and plated in E8+RI ...
-
bioRxiv - Microbiology 2020Quote: ... Infected CD4 T cells were washed with PBS and 3 million cells per condition were resuspended in 20uL buffer P2 (Lonza) with 4μM IDT electroporation enhancer ...
-
bioRxiv - Immunology 2022Quote: ... Thawed PBMCS were rested for 3-4h at 37°C in X-VIVO 15 Serum-free Hematopoietic Cell Medium (Lonza) supplemented with 5% human Ab serum ...
-
bioRxiv - Biochemistry 2019Quote: ... 3×107 cells were transfected with 10 μg of NotI linearized plasmids using the AMAXA electroporator (Lonza, program X-001) as described [14] ...
-
bioRxiv - Genetics 2020Quote: ... ∼1×106 cells were transfected with pairs of 5 µg gRNA plasmid and 4 µg ssODN (Supplementary Table 3) using AmaxaTM Human CD34 Cell NucleofectorTM Kit (Lonza) in the 2B-NucleofectorTM on the U-08 setting ...
-
bioRxiv - Neuroscience 2020Quote: ... The spinal cord was spun at 3000 rpm for 3 min at room temperature after which the embryonic medium was replaced with 1x trypsin-EDTA (Lonza). The tissue was macerated in trypsin and incubated at 37°C for 15-20 mins ...