Labshake search
Citations for Lonza :
451 - 500 of 1857 citations for Mouse WD repeat containing protein WRAP73 WRAP73 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 1.5-2.0 x 105 cells were electroporated with 200 pmol of protein in 20 µl cuvettes using a 4D nucleofector device (Lonza) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... Sf21 cells seeded at 500,000 cells/mL were transfected with recombinant bacmid DNA to generate the initial baculovirus (P1) in Insect-XPRESSTM Protein-free Insect Cell Medium (Lonza). The P1 virus was amplified two times (P2 and P3 ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Neuroscience 2019Quote: ... Ganglionic eminences and cortex were dissected and dissociated cortical neurons were nucleofected with ON-TARGET plus mouse Mecp2 siRNA or Non-targeting siRNA 1 (Dharmacon) according to the protocol of Amaxa Nucleofection (Lonza). Then neurons were plated into microchambers coated with poly-D-lysine (0.1 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: 1-4 × 106 dissociated cells were re-suspended in 100 µL of Amaxa Mouse NSC Nucleofector Solution (VPG-1004, Lonza) with 5 µg of plasmid DNA ...
-
bioRxiv - Immunology 2020Quote: ... Rinsed cells were resuspended in buffer P4 (mouse) or P2 (human) at 1-10 x 106 cells/20 μL (Lonza). Non-targeting Alt-R crRNA #1 ...
-
bioRxiv - Microbiology 2022Quote: ... Blood schizont purification was performed using a Nycodenz (Axis Shield) gradient following the culture of infected mouse blood in RPMI 1640 (Lonza) supplemented with 50 µg/ml neomycin (Sigma ...
-
bioRxiv - Pathology 2020Quote: ... Male transgenic uPA+/+/SCID mice were transplanted as previously described.33 The following PHH donors were used: cryopreserved or mouse-passaged (mp)PHH1 (HUM4188, Lonza), cryopreserved or mpPHH2 (HUM4129 ...
-
bioRxiv - Immunology 2021Quote: ... Naïve T cells expressing Cas9 were washed once with 1 mL pre-warmed recovery medium (Mouse T Cell Nucleofector Medium, Lonza) before electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse embryonic fibroblasts (MEFs) or African green monkey kidney fibroblasts (COS7) were cultured (37°C, 5% CO2) in DMEM (Lonza), supplemented with 10% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... was prepared by mixing 250 nmol target gene sgRNA+ 50 nmol eGFP sgRNA+ 50 nmol SpCas9 2NLS Nuclease (Synthego) in 50 μL mouse B cell nucleofection buffer (Lonza) at RT for 30min ...
-
bioRxiv - Pathology 2020Quote: ... The purity of the final recombinant proteins was determined to be more than 99% by sodium dodecyl sulfate and polyacrylamide gel (SDS-PAGE) with an endotoxin concentration lower than 2 units/mg protein measured by Limulus Amebocyte Lysate PYROGENT™ 125 Plus (Lonza). In previous experiments we demonstrated that these recombinant proteins were functionally devoid of significant endotoxin contamination ...
-
bioRxiv - Immunology 2020Quote: ... Six micrograms of plasmid DNA encoding the cDNA of the desired proteins was used for a single transfection reaction using program T-019 on the Amaxa Nucleofector II (Lonza, MD).
-
bioRxiv - Neuroscience 2023Quote: ... TG trigeminal ganglion neurons were transfected with 3 µg of NaV1.7-PEPCy3 plasmid and 0.75 µg green fluorescent protein (GFP) using the rat neuron 4D-Nucleofector solution (P3 Primary Cell Solution, program DR 114; Lonza Biosciences). Neurons were plated on round bottom glass dishes (cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were periodically tested for mycoplasma using the EZ-PCR™ Mycoplasma Detection Kit (Biological Industries, Cromwell, CT, USA) and the MycoAlert™ Mycoplasma Detection Kit (Lonza, Basal, Switzerland) and were confirmed to be mycoplasma free ...
-
bioRxiv - Cancer Biology 2021Quote: ... using buffer R (Amaxa Nucleofector Kit R VCA-1003; Lonza) and program R-001 ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA delivery was performed using either Nucleofector Kit V (Lonza) or Neon transfection system (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... contamination with the MycoAlert Mycoplasma Detection kit (Lonza LT-07). Cell lines were not authenticated.
-
bioRxiv - Neuroscience 2020Quote: The adenylate kinase assay (ToxiLightTM bioassay kit LT07-217 Lonza) to assess toxicity was performed following the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 days after nucleofection with the AMAXA Nucleofector Kit (Lonza), we applied puromycin selection until we observed the appearance of green colonies ...
-
bioRxiv - Cell Biology 2019Quote: ... MCF 10A cells were cultured in the MEGM kit (Lonza) at 37°C with 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... with a 20 μl P3 solution kit (Lonza, #V4XP-3032) with 600k PGP1 WT cells in each 20 μl reaction well as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Mycoplasma contamination was tested using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Immunology 2021Quote: ... Cells were transfected using the Amaxa HUVEC Nucleofector kit (Lonza) according to the manufacturer’s protocol (2-5 µg plasmid DNA ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with EGM Endothelial Cell Growth Medium SingleQuots Kit (Lonza) and used at passage 3-6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were suspended in EGM Media with Bullet Kit (Lonza) supplemented with 1μM Chiron ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with recommended growth supplement kit (EGM-2MV BulletKit, Lonza). Mouse mammary carcinoma cell line 4T1-luc-red (generously given by the Cross laboratory at University of Virginia ...
-
bioRxiv - Cell Biology 2021Quote: ... using the Amaxa human keratinocyte Nucleofector kit (Lonza, #VPD-1002) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... fibroblasts were transfected by nucleofection (Kit V4XP-2024, Lonza, Switzerland) with the gene drive plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... and using the Amaxa human CD34+ cells Nucleofection Kit (Lonza), following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... from the P3 Primary Cell 96-well Nuclofector kit (Lonza). 3 µL of the assembled Cas9 RNPs were added to the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma testing using the MycoAlert detection kit (Lonza, Ben OR) was performed every 2 months ...
-
bioRxiv - Immunology 2022Quote: ... Cells were nucleofected using Cell Line Nucleofector Kit V (Lonza) for cell lines and P3 Primary Cell 4D-Nucleofector X Kit L (Lonza ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in a supplemented (EGM-2 bullet kit, LONZA) endothelial cell growth medium (Lifeline Cell Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma infection monitoring was performed using MycoAlert Detection Kit (Lonza) and only mycoplasma-free cultures were used.
-
bioRxiv - Cancer Biology 2021Quote: ... based on routine testing with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2021Quote: ... tested for mycoplasma contamination using the MycoAlert Microplasma Kit (Lonza), and cultured with 0.2-micron filtered DMEM media (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mycoplasma screening was performed using a MycoAlert detection kit (Lonza). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cells were kept in HCM medium (HCM Bullet Kit, Lonza) supplemented with “singlequots” supplied with the kit (except for the EGF ...
-
bioRxiv - Cancer Biology 2020Quote: ... as screened with the MycoAlert® Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... using the MycoAlert PLUS assay kit from Lonza (Basel, Switzerland), and were authenticated by short tandem repeat profiling.
-
bioRxiv - Neuroscience 2021Quote: ... 4D-Nucleofector™ unit X Kit (program CA-137; Lonza) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were tested for mycoplasma using a MycoAlert Kit (Lonza), and for bacteria ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
bioRxiv - Cell Biology 2023Quote: ... Nucleofection was performed using the Amaxa MEF2 Nucleofector Kit (Lonza) following the manufacturer’s suggested protocol ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... with the P3 Primary Cell X kit (Lonza, V4XP-3024). ES cells clones were picked and screened for successful homologus CRISPR by PCR using primers designed outside of the CRISPR guide region (AAGGCTGTCTAGCACTCGTT ...
-
bioRxiv - Neuroscience 2023Quote: ... using the P3 Primary Cell nucleofector kit (Lonza, V4XP-3012). 8×105 cells were resuspended in 100µl P3 solution ...
-
bioRxiv - Biochemistry 2023Quote: ... Using Amaxa SF Cell Line 4D-Nucleofector X Kit (Lonza), WT HEK293T cells were transfected with a transposase-encoding plasmid (pSB100X) ...
-
bioRxiv - Biochemistry 2022Quote: ... Cultures were tested regularly with MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Bioengineering 2023Quote: ... SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol ...