Labshake search
Citations for Lonza :
451 - 500 of 1994 citations for Arg8 Vasopressin AVP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: PBT cells were transfected with 5 μg DNA for 5.106 cells in 100 μl of Human T Cell Nucleofector Solution (Lonza) with the program U-014 (Amaxa Biosystems).
-
bioRxiv - Immunology 2021Quote: ... Naive CD4+ T cells were cultured at 5% CO2/37°C in serum-free X-Vivo 15 medium (Lonza).
-
bioRxiv - Microbiology 2021Quote: ... HXGPRT amplicon (2-5 µg) into 1x106 RH TIR1-3FLAG tachyzoites in P3 buffer using a 4D-nucleofector (Lonza) with pulse code FI-158 ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight at 4°C with 25μL of SEC fractions 1 to 5 diluted 1:2 with PBS (Cat. No. LZBE17-512F, Lonza). Wells were washed with 0.05% Tween-20 (Cat ...
-
bioRxiv - Microbiology 2022Quote: ... and the well was gently washed once with 5 mL of phosphate buffered saline (PBS, Lonza, Rockland, ME, USA) to remove un-adherent floating bacteria ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were pelleted at 1000 rpm for 5 min and resuspended in 100 μL nucleofector solution (Lonza, #VPB-1002) before adding 2.5 μg of plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: Plasma cholesterol was depleted by treating HEK293 cells with 5 mM MβCD for 30 min in Pro293A-CDM (Lonza); this short period of MβCD treatment was deemed sufficient to removed 50% of endogenous cholesterol from cells (34) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Genomics 2021Quote: ... 23 uL of the cells-RNP-ssODN mixture were added to each well of a 96 well electroporation cuvette plate (Lonza, Cat #VVPA-1002), and nucleofected using the pulse code EH-115 ...
-
bioRxiv - Neuroscience 2022Quote: ... Harvested EBs were transferred to a tissue-culture treated 6-well plate (Falcon, #353224) in 3 ml of EB Differentiation media: X-VIVO 15 (Lonza Biosciences, #04-418Q) + 1% Glutamax (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... All cell lines used in the study tested negative for mycoplasma contamination when assayed with either the Universal Mycoplasma Detection Kit (ATCC 30-1012K) or the MycoAlert Detection Kit (Lonza LT07-418). Tunicamycin and thapsigargin were purchased from Sigma-Aldrich or from Tocris ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were resuspended and transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25 µL electroporation cuvette (Lonza). Electroporation of GCaMP mutants was performed according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... 3 x 107 bloodstream form cells were harvested by centrifugation and transfected with 5-10 μg of linearized plasmid DNA using an Amaxa Nucleofector II (Lonza) with program X-001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution electroporation cuvettes (Lonza). Electroporation was performed according to the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... of four genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 °C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
bioRxiv - Bioengineering 2020Quote: ... were cultured under standard incubation conditions at 37 °C and 5% CO2 in endothelial growth media (EGM BulletKit CC-3124, Lonza). For all imaging experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were maintained in culture at 37°C with 5% CO2 and regularly screened to ensure the absence of mycoplasma contamination (MycoAlert, Lonza).
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were grown in a humidified incubator at 37°C with 5% CO2 and routinely tested for mycoplasma infection (MycoAlert, Lonza). The identity of the cell line was confirmed by DNA fingerprinting (Laragen ...
-
bioRxiv - Microbiology 2020Quote: ... was combined with 15 pmol total synthetic sgRNA (5 pmol each sgRNA) (Synthego) to form ribonucleoproteins (RNPs) in 20uL total volume with SE Buffer (Lonza). The RNP assembly reaction was mixed by pipetting up and down and incubated at room temperature for 10 minutes.
-
bioRxiv - Microbiology 2021Quote: ... duncani parasites were maintained in A+ hRBCs (American Red Cross) at 5% hematocrit in HL-1 base medium (Lonza 344017) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 in Iscove’s modified Dulbecco’s medium (IMDM; Lonza, Basel, Switzerland) with 2 mM Ultraglutamine (Lonza) ...
-
bioRxiv - Bioengineering 2022Quote: Two donors of human mesenchymal stem cells (hMSCs) at passage 5-6 were seeded on mineralized collagen scaffolds for osteogenesis experiments (seeded separately, BM-17, Lonza, Maryland ...
-
bioRxiv - Immunology 2022Quote: ... activated-DC were washed twice in PBS 1X and put in culture with allogeneic naive CD4+ T cells (104 DC and 5×104 T) in X-VIVO 15 media (LONZA) for the indicated time ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel electrophoresis after visual read-out of the LAMP assay was done by loading 5 µl of the lamp reaction with 5 µl 2x loading dye on a 1.5 % agarose (Seakem LE Agarose, Lonza #50004) together with 5 µl of a 1kB DNA Ladder (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected by combining 5×105 viable cells with 400 ng plasmid DNA and nucleofection solution in a 25-μL electroporation cuvette (Lonza). Cells were electroporated according to the manufacturer’s protocol.
-
bioRxiv - Bioengineering 2019Quote: ... mCherry-transfected) were cultured at 37°C in 5% CO2 in EGM®-2 Endothelial Cell Growth Medium-2 (Lonza). Patient-derived glioblastoma multiform (GBM ...
-
bioRxiv - Genetics 2019Quote: For gene editing 2×106 ESCs were transfected with 2 μg Cas9-GFP-guide plasmid and 5 μl of 100 μM ssODN repair templates (180 bp, IDT ultrameres) using electroporation (Nucleofector, Lonza). Cells were resuspended in 100 μl of P3 solution (Lonza ...
-
bioRxiv - Microbiology 2019Quote: ... All experiments were done with cells at passage 2 to 5 and cells were regularly checked for mycoplasma contamination (MicoAlert Lonza).
-
bioRxiv - Cell Biology 2019Quote: ... HUVE cells were cultured in endothelial growth medium supplemented with 5% fetal bovine serum (FBS) and growth factors (EGM-2; Lonza). HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ug of each construct were nucleofected into BTSC73 or BTSC147 using an AMAXA nucleofector 2b device (Lonza, #AAB-1001). The GFP and RFP positive cells were then sorted two days post-electroporation and plated clonally using FACSAria Fusion ...
-
bioRxiv - Genetics 2019Quote: ... They were then transfected by nucleofection with 5 μg DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the C-016 program (Amaxa Biosystems) ...
-
bioRxiv - Immunology 2021Quote: Human telomerase-immortalized corneal epithelial (hTCEpi) cells (26) were maintained at 37°C/5% CO2 in regular keratinocyte growth medium KGM-2 (Lonza). Prior to treatment ...
-
bioRxiv - Immunology 2021Quote: ... CD3/CD28 beads were removed 48 hours after stimulation and 5 × 106 CTLs were electroporated with 2 μg plasmid using 4D-Nucleofector (Lonza). Medium was changed 6 hours after nucleofection and transfected cells were used 24-36 hours after electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse embryonic fibroblasts (MEFs) or African green monkey kidney fibroblasts (COS7) were cultured (37°C, 5% CO2) in DMEM (Lonza), supplemented with 10% fetal bovine serum (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer instructions and seeded at 5×105 cells/mL in RPMI-1640 media with L-glutamine (Lonza) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: BHK-21 cells (clone BSRT7/5) constitutively expressing the T7 RNA polymerase (21) were grown in Dulbeco Modified Essential Medium (Lonza) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... complexes for each peak to be deleted were prepared individually by mixing 120 pmol of sgRNA with 20 pmol of Cas9 protein (QB3 MacroLab, University of California, Berkeley) in 5 ul of P3 primary cell nucleofection buffer (Lonza) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells were grown in fifteen 25 cm2 flasks at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were used at passages 3-5 for experiments and cultured at 37°C and 5% CO2 in complete EC basal medium containing growth factors EGM2-Bulletkit (Lonza) to ensure a stable environment for optimal cell growth ...