Labshake search
Citations for Lonza :
451 - 500 of 2180 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... with 2% penicillin- streptomycin-amphotericin B (PSF; Lonza) and kept on an ice pack ...
-
bioRxiv - Neuroscience 2021Quote: ... Tissues were washed 3-4 times over 1 hour in PBS (calcium- and magnesium-free; Lonza BioWhittaker #17-517Q) containing 0.1% Triton X-100 (PBT ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genetics 2022Quote: CRISPR plasmid constructs (2 μg) were electroporated into 2 × 106 Raji cells using the Amaxa Cell Line Nucleofector Kit V (Lonza Bioscience) (Program M-013) ...
-
bioRxiv - Immunology 2020Quote: ... while lung microvascular cells were maintained on uncoated plates in Microvascular Endothelial Cell Growth Medium-2 (EGM-2 MV; Lonza, UK). Nasal epithelial cells were maintained in Airway Epithelial Growth Media (Promocell ...
-
bioRxiv - Immunology 2020Quote: ... Aortic and blood outgrowth endothelial cells were maintained on uncoated plates in Endothelial Cell Growth Medium-2 (EGM-2; Lonza, UK), while lung microvascular cells were maintained on uncoated plates in Microvascular Endothelial Cell Growth Medium-2 (EGM-2 MV ...
-
bioRxiv - Cell Biology 2021Quote: ... Media was then changed to EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were purchased from ATCC and cultured in EBM™-2 Endothelial Cell Growth Basal Medium-2 containing bullet kit growth factor supplements (Lonza), 5% fetal bovine serum ...
-
bioRxiv - Bioengineering 2023Quote: hBMVECs were purchased from Angio-Proteomie (Catalog #cAP-0002) and cultured in microvascular endothelial cell growth media 2 (EGM-2-MV) purchased from Lonza (Catalog #CC-3202). HDFn were purchased from ATCC (Catalog # PCS-201-010 ...
-
bioRxiv - Cell Biology 2022Quote: ... hVECs and pVECs were cultured in EGM™-2 MV Microvascular Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, #CC-3202). hVICs and pVICs were cultured in VIC medium ...
-
bioRxiv - Bioengineering 2020Quote: ... Fluidic lines were coated with 1% gelatin which was replaced by EGM-2 (Lonza) for up to 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: HUVECs were grown on 1% gelatin-coated plates in EGM-2 medium (Lonza: CC3156) for 48 hrs ...
-
bioRxiv - Physiology 2023Quote: ... USA) were cultured in 5% fetal bovine serum containing endothelial cell growth medium (EGM-2; Lonza, Basel, Switzerland). Media was supplemented with heparin ...
-
bioRxiv - Bioengineering 2022Quote: ... Calu-3 cells were maintained in EMEM (with EBSS and L-glutamine, BioWhittaker, Lonza) supplemented with 20% FBS (heat-inactivated ...
-
bioRxiv - Bioengineering 2022Quote: ... Human umbilical vein endothelial cells (HUVECS; C2519A) were cultured in EGM-3 medium (Lonza) and were used passages 2-3 for organoids fabrication ...
-
bioRxiv - Developmental Biology 2022Quote: A single cut in the NKX2.2 3’UTR was made using transient transfection (Lonza Human Stem Cell Nucleofector Kit VPH-5012 ...
-
bioRxiv - Immunology 2023Quote: ... The remaining erythrocytes were lysed with 3 mL ACK lysing buffer (Lonza, Basel, Switzerland) for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosomes were purified and excised from a 3% NuSieve GTG agarose gel (Lonza #50081) using Zymoclean Gel DNA Recovery Kit (Zymo #D4008) ...
-
bioRxiv - Bioengineering 2024Quote: Primary human hepatocytes from 3 different non-diseased donors were obtained commercially (Lonza, #HUCPI). These were quality-controlled ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged 1:10 every 3-4 days by trypsinisation and were regularly screened for mycoplasma contamination (Mycoalert, Lonza).
-
bioRxiv - Cell Biology 2024Quote: ... together with a plasmid encoding the piggyBac transposase in a 3:1 ratio (vector:transposase) using the P3 Primary cell 4D-Nucleofector™ kit (Lonza). Prior to targeting ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Measured tissues originated from six F508del homozygous patients (CF patient #1: CF-AB0609, female, 31 years-old; CF patient# 3: #28388-0000450918, Lonza, male ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cells were first electroporated with a PiggyBac-configured plasmid containing the Dox-inducible NbALFA-ABEL degrader cassette and a plasmid encoding the PiggyBac transposase at a 3:1 mass ratio via nucleofection (solution E with program CM138) according to manufacturer’s instructions (Lonza Inc.), followed by puromycin selection (5μg/ml ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The optimised sequences were used to design gBlocks with appropriate overhangs (Fig. 1-3) and cloned into pMAX-GFP plasmid from Lonza, digested with KpnI and SacI (Fig ...
-
bioRxiv - Bioengineering 2024Quote: SP8 or DP T cells were isolated as described above and stimulated in vitro using irradiated K562 CD19-CD137L aAPCs at a 1:3 aAPC:T cell ratio in X-VIVO™ 15 (Lonza), supplemented with 5% human AB serum (Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... The supernatants were pelleted at 350 xg for 10 min and resuspended in Endothelial Cell Growth Basal Medium-2 (EBM-2, CC-3156, Lonza, Morristown, NJ). Isolated NPCs were stained with SYTOX® Red (5uM ...
-
bioRxiv - Cell Biology 2022Quote: ... from Lonza were cultured in T-75 cell culture flasks in Endothelial Cell Growth Medium-2 (EGM-2) (BulletKit, Lonza, Cat. No. CC-3162). EGM2 was made from Endothelial cell Basal Medium – 2 (EBM2) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... human aortic endothelial cells (CD31+) from were maintained in EGM™-2 Endothelial Cell Growth Medium-2 Bullet Kit™ (Cat # CC-3162; Lonza) and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200 MEM-NEAA supplemented with dual SMAD inhibitors: 2 μM Dorsomorphin (StemMACS, cat. #130-104-466) and 2 μM A-83-01 (Lonza, cat. #9094360). On day 6 ...
-
bioRxiv - Immunology 2022Quote: ... puromycin containing medium were changed and every 4 days cells were fed EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Bioengineering 2023Quote: ... BOECs were generated from peripheral porcine blood as previously described.13 BOECs were maintained in endothelial growth medium-2 (EGM-2) (#CC-3162, Lonza, Portsmouth, NH) supplemented with 10% fetal bovine serum (#F08BB22A1 ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVEC) were purchased from ATCC (Manassas, VA, USA) and cultured in EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza, Basel, Switzerland) at 37°C with 5% CO2 and 95% air conditions until passage 5 ...
-
bioRxiv - Physiology 2024Quote: ... These cells were cultured in complete endothelial cell growth medium-2 (EGM-2) supplemented with the Bullet Kit (Lonza Biologics, Basel, Switzerland) and a 1% v/v penicillin-streptomycin antibiotics cocktail ...
-
bioRxiv - Biophysics 2021Quote: ... were grown in EGM-2 medium (Lonza, Basel, Switzerland). To express progerin in HUVECs ...
-
bioRxiv - Cell Biology 2020Quote: ... with complete medium EGM-2 Bulletkit (CC-3162, Lonza) supplemented with 0.01% Penicillin/Streptomycin (#15140122 ...
-
bioRxiv - Biochemistry 2020Quote: ... pooled from multiple donors were purchased from Lonza and maintained in EGM-2 supplemented growth media (Lonza). All cells were maintained in a 5% CO2 incubator at 37 °C.
-
bioRxiv - Bioengineering 2021Quote: ... were cultured in Endothelial Growth Medium 2 (EGM2) (Lonza) supplemented with plasmocin prophylactic (Invivogen ...
-
bioRxiv - Bioengineering 2020Quote: ... HUVECs were cultured in EBM-2 (Lonza, Walkersville, MD) containing supplements from the EGM-2 kit ...
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with FBS and an EGM-2 BulletKit (Lonza) optimized for HUVEC culture ...
-
bioRxiv - Bioengineering 2020Quote: ... were purchased from Lonza and were cultured in EGM-2 media (Lonza, Switzerland). MDA-MB-231 breast cancer cells were purchased from ATCC and cultured in DMEM (low glucose ...
-
bioRxiv - Cell Biology 2021Quote: ... and cultured in EGM-2 medium (Lonza, CC-3162). All cell lines were genotyped to confirm their identity at Genewiz ...
-
bioRxiv - Cancer Biology 2020Quote: ... were cultured in EGM-2 medium (Lonza, Wokingham, UK).
-
bioRxiv - Cell Biology 2021Quote: ... CD31+ endothelial cells were expanded in EGM-2 (Lonza) in Matrigel flasks and cryopreserved.
-
bioRxiv - Biophysics 2020Quote: ... we added buffer (2 μL 10x MOPS buffer, Lonza) and loading dye (8 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... ascorbic acid and heparin (EGM-2 SingleQuots Supplements, Lonza). Cells were grown in T-75 flasks ...
-
bioRxiv - Cell Biology 2020Quote: ... iPSCs were resuspended in nucleofection solution 2 (Amaxa; Lonza) with 10 μg of donor plasmid and 3 μg of ZFN messenger RNA per 2 × 106 cells ...
-
bioRxiv - Bioengineering 2021Quote: ... Endothelial cells were cultured in EGM-2 medium (Lonza). Human mesenchymal stem cells (hMSCs ...
-
bioRxiv - Bioengineering 2022Quote: ... were cultured in Endothelial Growth Medium 2 (EGM2, Lonza). Cells were maintained at 37 °C and 5% CO2 and were used before passage 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... Endothelial basal medium-2 was from Lonza (Basal, Switzerland). Fetal bovine serum (FBS) ...