Labshake search
Citations for Lonza :
451 - 500 of 1156 citations for 6 Methoxy 3 4 Dihydro 2H Quinoxaline 1 Carboxylic Acid tert Butyl Ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg of plasmid DNA was introduced to 4×106 neurons using an AMAXA nucleofection kit (VPG-1001, VPG-1003; Lonza). AMAXA-nucleofected cells were plated in 35mm glass bottom imaging dishes ...
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Cell Biology 2022Quote: ... and 20 μg of the donor DNA using the Amaxa 4-D Nucleofactor X machine (Pulse code FP158) and P3 Primary Cell Kit (Lonza), according to protocols described by Moon et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... the paired RNPs were combined and nucleofected into 4×105 Raw 264-7 cells suspended in 10 ul of nucleofection buffer (Lonza) using the program DS-136 in a 4D Nucleofector X Unit (Lonza) ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were nucleofected with 4 µg of the sgRNA-containing plasmid individually following the Amaxa Mouse ES cell Nucleofector kit recommendations (VPH-1001, Lonza). Later ...
-
bioRxiv - Neuroscience 2024Quote: ... Four wells of EBs per line were seeded in a 4-layer cell discs coated with growth factor-reduced matrigel in X-VIVO15 medium (Lonza) supplied with GlutaMAX (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... 1% NEAA (Lonza), 1% N2 supplement (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% Ultraglutamine (Lonza)) in each well ...
-
bioRxiv - Genetics 2022Quote: ... 1% glutamine (Lonza) and 1% penicillin-streptomycin (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Five milligrams of niclosamide inhalation powder was loaded into size #3 hydroxypropyl methylcellulose capsules (Vcaps® plus, Capsugel®, Lonza, Morristown, NJ, USA). The aerodynamic properties of the powder were evaluated using a Next Generation Impactor (NGI ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: ... ES cells were grown in 1:1 mixture of DMEM (Lonza BioWhittaker Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... neutralized 1:1 with Trypsin Neutralising Solution (TNS, Lonza, #CC-5002), spun down and concentrated to 15*106 cells/mL in EGM-2 ...
-
bioRxiv - Microbiology 2021Quote: ... 1% penicillin/streptomycin and 1% sea-plaque agarose (Lonza, Walkersville, MD). After a 2-days incubation ...
-
bioRxiv - Microbiology 2022Quote: ... A 1:1 mixture of Bronchial Epithelial Cell Basal Medium (Lonza) with Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2024Quote: ... at a 1:1 ratio overnight in X Vivo-15 (Lonza) supplemented with 2% KnockOut serum replacement (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2021Quote: ... Buffy coat cells were washed three times in 2.5 mM EDTA-PBS at 4°C before dilution and maintenance in RPMI-1640 supplemented with 10% FCS (PAA, AT or Lonza, CH) 2 mM glutamine ...
-
bioRxiv - Neuroscience 2023Quote: ... Nucleofection was performed using the 4-D nucleofector system (AMAXA) and the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024) following manufactures’ instructions (program CB-150) ...
-
bioRxiv - Genetics 2021Quote: Human embryonic microglia clone 3 (HMC3, ATCC® CRL3304™) cells were cultured in minimum essential medium (MEM) Eagle-EBSS with NEAA without L-Glutamine (Lonza, Cologne, Germany) supplemented with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: hTERT immortalized RPE-1 (RPE1) cell lines were grown in an 1:1 mix of DMEM and F-10 (Lonza) and Human Embryonic Kidney (HEK ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 100mM EDTA at pH 8.0 and 1 mg ml−1 lysozyme and mixed with the same volume of 1% SeaKem Gold Agarose (Lonza, USA) in TE buffer containing 10 mM Tris ...
-
bioRxiv - Synthetic Biology 2022Quote: 1 x 106 BHK-21 cells were electroporated with a total of 7.8 μg of mRNA (1:1:1 of pSinHelper, pSinCapsid and pTSin-EGFP/pTSin-SRF-NLS-VP64) using Amaxa 2B (Lonza) as per the manufacturer’s instructions for BHK-21 cells ...
-
bioRxiv - Physiology 2019Quote: ... 50 ng.mL−1 amphotericin B and 10 μg.ml−1 heparin (BulletKitTM, Lonza). Experiments were performed on cells from passage 2-5 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 IU ml-1 penicillin-100 µg ml-1 streptomycin mixture (Lonza), 200 mM L-glutamine (Lonza) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1 % antibiotic (Lonza). U2OS osteosarcoma cells were cultured at 37 °C in DMEM (Dulbecco’s Modified Eagle Medium ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% antibiotic-antimycotic solution (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% penicillin streptomycin (Lonza), 100 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% streptomycin/penicillin (Lonza), at 37° C with 5% CO2 and humidified atmosphere ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% penicillin/streptomycin (Lonza), 20 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... all cells were centrifuged at 220 xg RT for 5 min followed by resuspension with fresh complete media and plated at 1:5 (Cell Systems cells)-1:10 (Lonza cells) dilutions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1% Glutamine (Lonza), and seeded on Xona silicon device (#RD450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin (Lonza), and 1% L-glutamine (Lonza) ...
-
bioRxiv - Immunology 2022Quote: ... 1% L-glutamine (Lonza), and ...
-
bioRxiv - Genomics 2020Quote: ... 1% Na-pyruvate (Lonza), 1% non-essential amino acid solution (Lonza) ...
-
bioRxiv - Immunology 2020Quote: ... 1% P/S (Lonza), and 1 mM L-Gln (Lonza ...
-
bioRxiv - Immunology 2020Quote: ... 1% Pen/Strep (Lonza), 1% GlutaMAX™(Gibco) ...
-
bioRxiv - Biophysics 2022Quote: ... 1% penicillin–streptomycin (Lonza) and 2 mM L-glutamine (Lonza) ...
-
bioRxiv - Genomics 2022Quote: ... 1% penicillin-streptomycin (Lonza), 0.1 mM β-mercaptoethanol and 4 ng/ml FGF2 ...
-
bioRxiv - Immunology 2022Quote: ... 1% p/s (Lonza) (sort medium ...
-
bioRxiv - Immunology 2022Quote: ... 1% penicillin-streptomycin (Lonza) and 1% Ultra-glutamine (Lonza) ...
-
bioRxiv - Pathology 2022Quote: ... 1% L-glutamine (Lonza), and 0.1 mM 2-mercaptoethanol (Thermo-Fisher) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% L-Glutamine (Lonza), 0,4% sodium-pyruvate (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% sodium pyruvate (Lonza), 1% 1xnonessential amino acids (Lonza) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1% HEPES (Lonza)) ...
-
bioRxiv - Microbiology 2024Quote: ... 1% sodium bicarbonate (Lonza) and 2mM L-glutamine (Lonza) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Animals were sacrificed by cervical dislocation four days after electroporation and resected xenografts were fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate buffered saline (PBS) (Lonza, Basel, Switzerland) at 4°C for approximately one week ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...