Labshake search
Citations for Lonza :
451 - 500 of 509 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 1.5mL for a T75 flask for 5 minutes at 37° C and resuspended in 80 μL of SF cell line solution (Lonza; Basel) per flask ...
-
bioRxiv - Developmental Biology 2020Quote: ... about 8 × 105 iPSCs were transfected with 5 μg of plasmids with Lonza Human Stem Cell Nucleofector Kit 1 (Lonza, VPH-5012) on a Nucleofector 2b device (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were electroporated with either CFP-IRES or RBP-IRES-CFP vector (5 µg) using a 4D-Nucleofector (Lonza, program DS-112) in 16-well stripes (500,000 cells/well ...
-
bioRxiv - Cell Biology 2022Quote: ... and CD31+Rspo3+ cells were centrifuged at 500 g for 5 min and resuspended in 500 μl endothelial cell media: EGM-2 MV Bullet Kit (Lonza, cc-3202) supplemented with 50 ng/mL VEGF-C (R&D ...
-
bioRxiv - Systems Biology 2020Quote: Single-cell suspensions were pelleted at 400 x g for 5 min and washed once with 10 mL mammary epithelial basal medium (MEBM; Lonza CC-3151). For each sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Biophysics 2021Quote: ... ATCC-CRL 10317) were grown at 37°C and 5% CO2 in Mammary Epithelial Cell Growth Basal medium (MEBM from Lonza Pharma & Biotech), supplemented with 5% Horse Serum (HS ...
-
bioRxiv - Microbiology 2021Quote: ... Recovered cells were further depleted of red blood cells by resuspending cells with 5-ml of AKC lysis buffer (Lonza, Walkersville, MD). Following 5 min incubation at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... all cells were cultured at 37°C in a humidified 5% CO2 incubator in minimum essential medium Eagle α (Lonza; BE12-169F) supplemented with 10% (v/v ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transduced with Adenovirus-GFP (AV-Gfp) or Adenovirus-mHilpda (AV-Hilpda) at 5 × 106 IFU/mL media in DMEM (Lonza, Verviers, Belgium) supplemented with 10% fetal calf serum (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Microbiology 2022Quote: ... schizonts purified from an overnight culture of PbDiCre parasites were transfected with 5–10 µg of linearised plasmid by electroporation using the AMAXA Nucleofector device (Lonza, program U033), as previously described (Janse et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 cells were mixed with RNPs and transferred without forming bubbles to a 16-well Nucleocuvette© Strip (Lonza, V4XP-3032). Unless otherwise stated ...
-
bioRxiv - Systems Biology 2022Quote: ... All cells were grown at 37°C in 5% CO2 and regularly checked for mycoplasma (MycoAlert mycoplasma detection kit, Lonza, Basel, Switzerland). Identity of all cell lines was confirmed by STR analysis (Leibniz Institute DSMZ GmbH ...
-
bioRxiv - Immunology 2019Quote: ... were sorted into B cell media (IMDM medium, GIBCO; 10% heat-inactivated low IgG FBS, Life Technologies; 5 ml GlutaMAX, Life Technologies; 1 ml MycoZap plus PR, Lonza). Immediately following the sort ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dissociated cell suspension was cultured on rat tail collagen type I-coated dishes at 37 °C in 5% CO2 using Small Airway Epithelial Cell Growth Medium (SAGM; basal medium plus growth supplements, Lonza, CC-3118) containing 1% AA ...
-
bioRxiv - Neuroscience 2021Quote: ... Single-cell suspension of hiPSCs was nucleofected with 5 μg of the generated SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... All the cells were grown with 5% CO2 at 37°C and verified mycoplasma free using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218).
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1) using Human Stem Cell NucleofectorTM kit 1 (Lonza, VVPH-5012) according to the manufactures protocol and cells replated ...
-
bioRxiv - Cell Biology 2020Quote: ... NIH 3T3 and immortalized MVD7 cells were cultured at 37°C and 5% CO2 in high glucose DMEM culture medium (Lonza, Cologne, Germany) supplemented with 10% FBS (Biowest) ...
-
bioRxiv - Immunology 2021Quote: ... NIH AIDS Research and Reference Reagent Program) were grown at 37°C in a humidified atmosphere with 5% CO2 in RPMI 1640 medium (Lonza, Verviers, Belgium) in the case of the CEM.NKR-CCR5 cells ...
-
bioRxiv - Neuroscience 2020Quote: ... dissociated ganglia were pelleted at 100 x g for 5 min and resuspended in 100 µl ‘Nucleofector solution’ (Rat Neuron Nucleofector kit; Lonza, Alpharetta, GA). 4-6 μg of plasmid was electroporated using the AMAXA Nucleofector device (Neurons Rat DRG ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells lines were maintained in humidified 37°C the incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Developmental Biology 2022Quote: ... D-001206-14-05 5 nmol) and nucleofected into OPCs using the Basic Nucleofector Kit for Primary Mammalian Glial Cells (Lonza, VPI-1006) following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were fabricated using a solution consisting of lyophilized GelMA (5 wt%) dissolved at 37°C in phosphate buffered saline (PBS; Lonza 17-516F) and combined with 0.1% w/v lithium acylphosphinate (LAP ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell lines were maintained at 37°C in a humidified incubator containing 95% air and 5% CO2 and routinely tested for mycoplasma contamination with the MycoAlert Assay (Lonza, LT07-418). For experiments requiring manipulation of cystine availability ...
-
bioRxiv - Neuroscience 2023Quote: ... All cell lines used in this study were tested mycoplasma free by first culturing the cells for 3-5 days in antibiotic-free media and then subjected to a mycoplasma tested using MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza, UK).
-
bioRxiv - Cell Biology 2023Quote: ... All cells were cultured at 37 °C and 5% CO2 in a humidified incubator and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Neuroscience 2023Quote: ... 8 x 105 hiPSCs in single-cell suspension were nucleofected with 5 μg SpCas9-sgRNA plasmid using the P3 Primary Cell 4D-Nucleofector Kit (Lonza, #V4XP-3024) in combination with the 4D Nucleofector Unit X (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Genomics 2023Quote: ... All cells were cultured with 5% CO2 at 37°C and verified to be free of mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza, LT07-218). Wild type MCF7 cells were a gift from Howard Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells lines were maintained in a humidified 37°C incubator with 5% CO2 and routinely tested for mycoplasma contamination (Lonza #LT07-118).
-
bioRxiv - Molecular Biology 2023Quote: Induced pluripotent stem cells were transfected with a total of 5 μg target Cas9/gRNA plasmids with or without 1 μg repair templates using Human Stem Cell Nucleofector Kit (LONZA, Basel, Switzerland) and Nucleofector 2b device (LONZA ...
-
bioRxiv - Genomics 2023Quote: ... were washed twice with PBS and resuspended in a solution containing a 4.5:5 mixture of nucleofection buffer (Buffer SE, Lonza Lot #: S-09279) and supplement (Lonza ...
-
bioRxiv - Genomics 2023Quote: The AIDA Data Freeze v1 gene-cell matrix (1,058,909 cells from 503 Japan, Singaporean Chinese, Singaporean Malay, Singaporean Indian, and South Korea Asian donors and 5 distinct Lonza commercial controls), with BCR-seq and TCR-seq metadata ...
-
bioRxiv - Cell Biology 2024Quote: ... coated tissue culture polystyrene (TCPS) and maintained at 37° Celsius and 5% CO2 in endothelial growth medium (EGM-2 with bullet kit; Lonza, CC-3162) supplemented with 1% penicillin/streptomycin (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lines were cultured in a humidified incubator at 37°C and 5% CO2 and regularly tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza, LT07-418).
-
bioRxiv - Biochemistry 2024Quote: ... All the cells were maintained in a humidified incubator with 5% CO2 at 37 °C and tested negative for mycoplasma by MycoAlert (Lonza, Morristown, NJ). Cells from passage 14-15 (P14-15 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 million parasites were electroporated with 5-10ug of digested plasmid with an AMAXA Nucleofector II using X-001 in Human T-cell Nucleofector Solution (Lonza VPA-1002).
-
bioRxiv - Cancer Biology 2024Quote: ... All cells were cultured at 37 °C in 5% CO2 humidity and were tested routinely for mycoplasma using MycoAlert mycoplasma detection kit (Lonza, LT07-318) and appropriate positive control (Lonza ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were cultured at 37°C and 5% CO2 in DMEM (H3BE12-604F/U1, Lonza Group AG [Cultek S.L.U, Madrid, Spain]) supplemented with 10% tetracycline-free FBS (631106 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Microbiology 2020Quote: ... The final extension step was extended for 5 minutes and product size was confirmed by electrophoresis with a FlashGel™ DNA Kit (Lonza, Basel, Switzerland). PCR products were then purified with the DNA Clean & Concentrator kit ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Cells are spun at 1250 x g for 5 minutes and resuspended in 25 µl Lonza SF buffer (Lonza Cat. No. V4SC-2960) if cycloheximide selection will not be used or 200 µl of SF buffer if cycloheximide selection will be used.
-
bioRxiv - Molecular Biology 2023Quote: ... were grown in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... were expanded in 10 cm2 dishes in a humidified environment at 37°C with 5% CO2 in DMEM/F12 medium (Lonza Ltd. Basel, Switzerland) supplemented with 12.5% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... plates were incubated at 37°C for 30 minutes in blocking buffer (PBS with 1% BSA, 5% FBS, and 1% human AB serum (Lonza, Walkersville, MD, USA), washed three times in PBS with 0.05% tween 20 and incubated with a commercial anti-SARS-CoV-2 Spike antibody (1/1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... in 6-well tissue culture plates and were allowed to adhere for 5 hours before induction of serum starvation in EBM-2 (LONZA, Cat# CC-3156) for 16 hours prior to being administered media of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... cultured for 48 h at 37°C with 5% CO2 in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, UK) with penicillin–streptomycin (100_U/ml ...