Labshake search
Citations for Vector Labs :
1 - 50 of 362 citations for Adenovirus Type 5 Particles CMV GFP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... adenovirus-Cre (5×109 pfu, Vector lab, Baylor College of Medicine) was transduced in Ift20flox/flox limb mesenchymal cells at 37°C for overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Physiology 2022Quote: ... Recombinant GFP protein (Cat# MB-0752, Vector labs), diluted in S2R+ cell growth media (64ng/μl to 4 ng/μl) ...
-
bioRxiv - Physiology 2023Quote: ... Recombinant GFP protein (Cat# MB-0752, Vector labs), diluted in S2R+ cell growth media (64ng/μl to 4 ng/μl) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies (Goat anti-GFP biotin conjugated, Vector Labs; sheep polyclonal anti-human-sema3f antibody ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant GFP was purchased from Vector Laboratories (MB-0752). All oligonucleotides that were conjugated to antibodies ...
-
bioRxiv - Genetics 2021Quote: Collagen type I staining was developed with DAB (3,3’-diaminobenzidine) (SK-4103, Vector Laboratories), a horseradish peroxidase (HRP ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then mounted onto type 1.5 coverslips using VectaMount (H-5000, Vector Laboratories).
-
bioRxiv - Cell Biology 2019Quote: ... blocked with 5% BSA/5% normal goat serum (Vector Laboratories) in PBS-T ...
-
bioRxiv - Genetics 2021Quote: ... Collagen type II staining was developed with red alkaline phosphatase substrate (SK-5105, Vector Laboratories) that yields a magenta precipitate ...
-
bioRxiv - Neuroscience 2020Quote: ... To amplify the GFP reporter signal biotinylated secondary antibody (1:500; Vector Laboratories) was incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... A 5′ Cy5 fluorescent label was incorporated using the 5′ EndTag kit (Vector Labs) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... 5) ABC kit (Vector Labs); and 6 ...
-
bioRxiv - Immunology 2022Quote: ... 5 ml of lectin beads (Galanthus nivalis lectin (GNL)-agarose beads (Vector Labs: AL-1243-5) were added to the filtered transfected supernatant and rocked overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 5% normal goat serum (Vector Laboratories), 0.2%/1% triton-x (VWR ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were labelled for 5 min with 5 μg/mL 4’6-diamidino-2-phenylindole (DAPI, Vector Laboratories), and mounted using Mowiol (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2024Quote: ... Cells were then washed 5 x 5 mins with PBST and biotinylated secondary antibodies (1:50; Vector Laboratories) were added in blocking buffer for 2 h at RT ...
-
bioRxiv - Biochemistry 2020Quote: Biotinylated MPL (5 μg/mL, Vector Laboratories) was then added to the membrane in blocking buffer (1 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the 5′ EndTag kit (Vector Labs) as directed by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the 5′ EndTag kit (Vector Labs) as directed by the manufacturer ...
-
bioRxiv - Genetics 2024Quote: ... 5 mM THPTA (tris-hydroxypropyltriazolylmethylamine) (Vector Laboratories), 1 mM copper sulfate ...
-
bioRxiv - Bioengineering 2020Quote: ... MPBiomedicals, 1:5000) and collagen type II (No. 0863171, MPBiomedicals, 1:1000) was performed using the Vectastain ABC kit (Vector Labs) with hematoxylin counterstaining as in standard protocols (Scotti et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then rinsed with PBS (5 × 5 min) before placement in Vectastain ABC Solution (1:1000; Vector Laboratories) for 1 hour prior to rinsing (5 × 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Another PBS (5 x 5) wash was conducted before the tissue was incubated in Avidin-Biotin Complex (Vector Laboratories, Newark ...
-
bioRxiv - Neuroscience 2020Quote: ... washed with PBS for 5×5 min and slides were mounted with VECTASHIELD mounting medium with DAPI (Vector Laboratories, USA). The following primary antibodies were used ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in PBS (5 x 5 min) followed by a 1 hour incubation in Vectastain ABC Solution (1:1,000; Vector Laboratories). Sections were rinsed again prior to incubation in diaminobenzidine and hydrogen peroxide (0.02% diaminobenzidine/0.09% hydrogen peroxide in KPBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Engineered cartilage sheet sections were also treated with pronase and primary anti-Collagen Type II (DSHB II-II6B3) followed by VectaFluor R.T.U Antibody Kit DyLight® 488 (Vector Labs DI-2788) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5% Normal Goat Serum (NGS, Vector Laboratories) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... 5% Goat Serum (Vector Laboratories S-1000-20), 0.5% Tween-20 (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 5% goat serum (S-1000-20 Vector Laboratories), 3% mouse serum ...
-
bioRxiv - Biophysics 2020Quote: ... Purified RNA transcripts were labeled with fluorescein at their 5’ termini using the 5’ EndTag DNA/RNA Labeling Kit from Vector Laboratories following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then washed (5 x 5 min, 20 rpm) and processed with avidin-biotinylated horseradish peroxidase complex (Vectastain Elite Kit, Vector Laboratories) in 0.3% PBST for 1 h at room temperature (2 rpm) ...
-
bioRxiv - Genetics 2024Quote: ... for 1 hour and then in running tap water (5 minutes) and acetic acid (0,5%, 5 minutes) followed by dehydration and mounting with VectaMount™ Mounting Medium (Vector Laboratories). Images were obtained using a digital microscope (Keyence ...
-
bioRxiv - Cancer Biology 2020Quote: ... unspecific bindings (5% BSA, 5% NGS in PBST, 1h) and Avidin/Biotin (Avidin/Biotin Blocking Kit, Vector Laboratories, SP-2001, 15 min). Samples were incubated overnight at 4°C with anti-MDA antibody (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were then permeabilized using PBS with 0.1% Triton X-100 for 5 min and blocked in a 5% v /v goat serum (GS, Normal Goat Serum, S-1000, Vector Laboratories IVD) in PBS for 1 h at RT and incubated overnight at 4 °C with primary antibodies (aniP2RY1 ...
-
bioRxiv - Pathology 2022Quote: ... permeabilized in PBS with 0.1% Triton X-100 for 5 min and blocked in a 5% v/v goat serum (GS, Normal Goat Serum, S-1000, Vector Laboratories IVD) in PBS for 1 h at RT ...
-
bioRxiv - Immunology 2020Quote: ... and nonspecific epitopes (species-specific serum diluted 1:5 in Tris-buffered saline and 5% bovine serum albumin, or blocking serum from species specific ImmPRESS® kit; Vector Laboratories) and incubated with primary antibody (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... the tissue was washed in PBS (5 x 5) and incubated in biotinylated secondary antibody goat anti-rabbit (Vector Laboratories; BA-100) (1:500 in 1X PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 5% normal goat serum (Vector Laboratories, S-1000) and 0.1 % Triton X-100 (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... blocking with 5% normal horse serum (Vector Laboratories, CA) in 2% bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2020Quote: ... for 5 min and mounted with VectaMount (Vector Labs).
-
bioRxiv - Neuroscience 2019Quote: ... Slices were then rinsed 2 x 5 min in PBST and 2 x 5 min in PBS before mounting with VectaShield mounting media (Vector Labs, H-1000).
-
bioRxiv - Cell Biology 2019Quote: ... fixed in 4% paraformaldehyde 20 minutes (5 min in methanol for anti-GluRIIA) and subsequently blocked in 5% Normal goat serum (Vector laboratories #S-1000) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was washed with 0.1 M TBS (5 × 5) and the stain was allowed to develop for 2 minutes using an ImmPACT novaRED Substrate Kit (Vector Laboratories, SK-4805). Tissue sections were then washed for 5 min in tap water ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was then washed with 0.1 M TBS (5 × 5 min) and incubated in ImmPRESS HRP goat anti-rabbit IgG polymer detection kit reagent (Vector Laboratories, MP-74551) for 18 h at 4 °C ...
-
bioRxiv - Physiology 2023Quote: ... Muscle sections were incubated in 1:1000 Wheat germ agglutinin (WGA– fluorescein 5 μg/mL; Cat# FL-1021-5, Vector Laboratories Ltd., Peterborough, UK) for 10 min followed by three washes of PBS-T for 5 min each ...
-
bioRxiv - Bioengineering 2020Quote: ... blocked with 5% normal horse or goat serum (Vector Laboratories) in 2 (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated with 5% serum (Vector Laboratories, Burlingame, CA) or 5% BSA w/v in PBS for 1h before they were incubated with the respective primary antibody ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% normal goat serum (S-1000, Vector Laboratories, Burlingame, CA) was applied for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were blocked with 5% normal donkey serum (Vector Laboratories) and 0.1% Triton-X in 0.01M PBS and incubated with primary antibodies diluted in blocking solution overnight at 4°C ...