Labshake search
Citations for Vector Labs :
2051 - 2100 of 2609 citations for Tumor Protein Translationally Controlled 1 TPT1 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... DyLight 594 Conjugate at 1:100 dilution (DL-1207, Vector Laboratories, Burlingame, CA) and anti-Cardiac Troponin T Ab at 1:00 dilution (15513-1-AP ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... Incubation with primary antibodies was followed by a biotinylated goat-anti-rabbit antibody for 30 min followed by the avidin–biotin–peroxidase complex (Vectastain Elite ABC Kit, Vector Laboratories, PK 6100; Burlingame, CA, USA) for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed in PBST and incubated for 60 minutes at room temperature with a secondary biotinylated goat anti-rabbit antibody (Vector laboratories, Cat# BA-1000, lot# 2F0430) diluted 1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by an ALP-coupled goat anti-mouse immunoglobulin G secondary antibody (ImmunoLogic, WellMed, MS Arnhem, Netherlands) and ImmPACT® Vector® Red Substrate (Vector Laboratories, Newark, CA, USA) visualization.
-
bioRxiv - Pathology 2023Quote: ... sections were incubated with biotinylated anti-mouse or anti-rabbit secondary antibody and then with avidin-biotin complex using the Elite Vectastain kit (Vector Laboratories, PK-6101 and PK-6102). Chromogen reactions were performed using diaminobenzidine (SIGMAFAST DAB ...
-
bioRxiv - Developmental Biology 2020Quote: For pronephros analysis a fluorescein–labeled Lycopersicon esculentum lectin (1:100 dilution; Vector Laboratories) was used for visualization ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were washed for 1 hr with PBSTx and mounted in VectaShield (Vector Laboratories).
-
bioRxiv - Neuroscience 2020Quote: ... followed by a blocking solution containing 1% normal goat serum (Vector Laboratories Cat#S1000) and 1% Triton X (VWR ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-goat or goat anti-rabbit (1:200, Vector laboratories Inc., Burlingame, USA). Antibodies were combined with standard ABC reagents (Vectastain Elite ABC kit ...
-
bioRxiv - Neuroscience 2020Quote: ... and visualized using biotinylated goat anti-rabbit IgG (1:200, Vector Laboratories, CA, USA). Signals were developed with the Vectastain ABC kit (PK-4001 ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-rabbit biotinylated secondary sera at 1:500 (Vector Laboratories, BA-1000). For the detection of the antibody with DAB ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h and mounted using Vectorshield mounting media with DAPI (H1200, Vector Laboratories). Images were captured using a Zeiss Axio Imager microscope (Carl Zeiss GmbH ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplification was achieved with avidin-biotin complex (1:400, ABC; Vector Laboratories, Peterborough, UK) for 2h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplification was achieved with avidin-biotin complex (1:500, ABC; Vector Laboratories, Peterborough, UK) for 2h at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 15 to 20 µL of 10 mg·mL−1 biotinylated BSA (Vector Laboratories, Burlingame CA) was introduced and allowed to bind to the glass surface for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... and Ulex Europaeus Agglutinin (UEA)1-Rhodamine (2μg/ml, Vector Laboratories #RL-1062-2) for 20min at 4◦C ...
-
bioRxiv - Cell Biology 2020Quote: ... tissue sections were incubated with biotinylated anti-mouse IgG (1:200 dilution, Vector Laboratories) for 1 h at room temperature then washed thrice ...
-
bioRxiv - Neuroscience 2022Quote: ... for 1 h and mounted using Vectorshield mounting media with DAPI (H1200, Vector Laboratories). Images were captured using a Zeiss Axio Imager microscope (Carl Zeiss GmbH ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sections for αSMA were blocked using mouse-on-mouse kit (MKB2213-1, Vector Lab) before primary antibody application for 35 minutes at a previously optimised dilution (αSMA ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 90 min amplification in avidin-biotin complex (ABC; Vector Lab, 1:500). Sections were then reacted in 3,3’-Diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2022Quote: ... 2003) in 1% BSA in TBS followed by anti-rabbit horseradish peroxidase (Vector Laboratories) in TBS-T ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µl stained sample was mixed with 3 µl Vectashield mounting medium (Vector Laboratories) and mounted on a slide ...
-
bioRxiv - Neuroscience 2020Quote: ... Labeling was amplified by avidin–biotin complex (1:1000; Vector Laboratories, Burlingame, CA, USA) by incubation for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-Mouse IgG (1: 2,000, Cat No: DI-2488, Vector Laboratories, Burlingame, CA). Each Western blot was performed using three independent biological replicates.
-
bioRxiv - Neuroscience 2019Quote: ... anti-rat or anti-mouse IgG (1:1,000, Vector Laboratories Inc., Burlingame, CA, USA) for 2 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... biocytin was labeled with DyLight 594 conjugated streptavidin (1:200, Vector Labs, SA-5594) to reveal if the recorded cell was coupled or not.
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were washed for 1 hr with PBSTx and mounted in VectaShield (Vector Laboratories).
-
bioRxiv - Developmental Biology 2021Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... and for 1 h with Vectastain® Avidin-Biotin Complex Staining kit (Vector Laboratories). Sections were developed in a Tris buffer solution (TBS ...
-
bioRxiv - Pathology 2020Quote: ... and incubated with biotinylated goat anti-mouse IgG (1:1000; Vector Laboratories, CA, USA) or biotinylated goat anti-rabbit IgG (1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... Capillaries were visualized by staining with lectin (Biotinylated Griffonia simplifolia Lectin 1; Vector lab), followed by a Streptavidin Qdot 655 (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 4’6’-diamidino-2-phenylindole (DAPI) diluted 1:5 in Vectashield mounting media (Vector Labs) was used as a counterstain ...
-
bioRxiv - Neuroscience 2020Quote: ... (iv) 1:100 peroxidase-avidin complex (Vectastain Elite Kit, Vector Laboratories, catalog PK-6100), 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in avidin–biotinylated horseradish peroxidase complex (Elite ABC; 1:300; Vector Laboratories) diluted in TBS for 3 h at room temperature or overnight at 4 °C ...
-
bioRxiv - Zoology 2021Quote: ... and biotinylated goat anti-rabbit IgG (BA1000, VECTOR Laboratories, Burlingame, CA, USA; 1:500) for 1 day at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Two 15-cm petri dish were incubated with BSL-1 (5μg/mL, Vector Labs) in D-PBS for at least 2 hours at room temperature (negative panning dishes) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
Hormonal contraceptives alter amphetamine place preference and responsivity in the intact female ratbioRxiv - Animal Behavior and Cognition 2021Quote: ... primary incubation used rabbit antiserum against FOS (1:2500; Vector Laboratories, Inc., Burlingame, CA) and secondary incubation used biotinylated goat anti-rabbit IgG (1:250 ...
-
bioRxiv - Cell Biology 2022Quote: ... Horse anti-rabbit biotinylated IgG (1:400; VC-BA-1100-MM15; Vector Laboratories; IF), streptavidin Alexa Fluor 555 conjugate (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were treated with biotinylated donkey-anti-mouse IgG (1:300; Vector Laboratories) for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated in avidin-biotin horseradish peroxidase complex kit (1:500, Vector Laboratories) in PBS containing 0.4% Triton-X for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...