Labshake search
Citations for Vector Labs :
2001 - 2050 of 2829 citations for Rat Palmitoyl Protein Thioesterase 1 PPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Cancer Biology 2021Quote: ... DAB was used as chromogenic method of detection and signal was developed using the VECTASTAIN Elite ABC HRP Kit (PK-6100; Vector laboratories) combined with ImmPACT DAB Peroxidase (SK-4105 ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5% TritonX-100 in PBS) for 30 min at RT followed by another blocking using M.O.M kit (Vector Laboratories BMK-2202). Primary antibodies (mouse anti-MYH3 ...
-
bioRxiv - Genetics 2021Quote: ... the slides were then incubated with blocking reagent from the Mouse-on-Mouse (M.O.M) kit (Cat# BMK-2202; Vector Laboratories; Burlingame, CA). Slides were incubated for one hour at room temperature in primary antibody ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was then tipped off for blocking the endogenous biotin suing the Avidin Biotin blocking kit from Vector labs (SP-2001). Sections were then fixed for 30 minutes with 10% Neutral buffered formalin (VWR-89370-094) ...
-
bioRxiv - Immunology 2022Quote: ... On day 3 secondary antibodies were added and visualised with the Vector Red Alkaline Phosphatase Substrate Kit (Vector Laboratories #SK-5100). For neutrophil elastase (NE ...
-
bioRxiv - Bioengineering 2019Quote: ... IHC staining was carried out using a standard protocol from Vectastain ABC Elite kit (Vector Labs, Burlingame, CA cat#PK-6101). Vector NovaRED (Vector Labs ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sections were washed and incubated with anti-rabbit or anti-mouse secondaries (ImmPRESS HRP Anti-Rabbit/Anti-Mouse IgG (Peroxidase) Polymer Detection Kit (Vector Laboratories). Antibody was detected with DAB solution (ImmPACT DAB Substrate Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Recognition of glycosylated sorLA by lectins was carried out applying biotinylated lectins (10 μg/mL; Biotinylated Lectin Kit I and Biotinylated SNA, Vector Laboratories) and peroxidase-conjugated streptavidin (Calbiochem ...
-
bioRxiv - Pathology 2020Quote: ... and a blue reaction product was produced by incubating sections with alkaline substrate (Vector blue AP substrate kit III, Vector laboratories) for 20 to 40 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... the slides were incubated with secondary antibody using an ImmPRESS™ HRP Anti-Mouse IgG (Peroxidase) Polymer Detection Kit (Vector Laboratories) for 60 min at RT ...
-
bioRxiv - Biochemistry 2019Quote: ... was carried out using a biotinylated secondary antibody together with the avidin-biotin system and the VECTOR peroxidase kit (PK-6100, Vector Laboratories) using diaminobenzidine tablets as a substrate.
-
bioRxiv - Physiology 2021Quote: ... Slides were incubated with 6% H2O2 for 30 min after primary antibody incubation and were then biotinylated with a rabbit IgG and ABC kit (Vector Labs) for immunohistochemistry ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 1 h at room temperature or overnight at 4°C and avidin/biotin or polymer horse radish peroxidase kits for primary mouse or rabbit antibodies (Vector Laboratories) were used for detection ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed the following day using a Vectastain kit (biotinylated goat-anti-rabbit igG secondary antibody and avidin-biotin-peroxidase complex) and ImpacDAB (Vector Laboratories). Control sections lacking the primary antibody were unlabeled ...
-
bioRxiv - Genetics 2021Quote: ... then blocked with 5% (v/v) horse serum (ImmPRESS HRP Anti-Rabbit IgG [Peroxidase] Polymer Detection Kit; Vector labs; MP-7401). Sections were incubated with rabbit anti-TCFL5 (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... DNMT3A and DNMT3B was visualized in cross-section (5 µm) of paraffin-embedded tissues using specific primary antibodies and a Vectastain Elite ABC Kit (Vector Laboratories) or AlexaFluor 488-conjugated secondary antibodies (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... Infected cells were visualized by labeling with anti-flavivirus E-glycoprotein antibody using a mouse VECTASTAIN ABC-horseradish peroxidase (HRP) kit (PK-4002; Vector Laboratories) and a DAB peroxidase substrate kit (SK-4100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sections were incubated with biotinylated secondary antibodies and the signal was revealed using the Vectastain Elite ABC-HRP peroxidase kit and the ImmPACT NovaRED HRP substrate (Vector laboratories). Counterstaining was performed using 50% Harris hematoxylin for 30 seconds followed by incubation in 0.1% sodium bicarbonate solution for 1 minute at room temperature.
-
bioRxiv - Microbiology 2022Quote: ... The wells were then washed twice with PBS and reacted with avidin/biotin-HRP complex (VECTASTAIN Elite ABC kit; Vector Laboratories) at 50 μL/well at 4 °C for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... We rinsed the sections again in PBS and incubated them in avidin–biotin– peroxidase complex (ABC Elite kit, PK‐6100, Vector Laboratories) in 0.5% PBS‐TX for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Color was developed by incubating the slides with freshly prepared avidin-biotin-peroxidase complex (ABC) solution (Vectastain Elite ABC Kit; Vector Laboratories), followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC ...
-
bioRxiv - Neuroscience 2020Quote: ... the tissue was incubated in biotinylated secondary antibody followed by incubation with the avidin-biotin complex solution (Vectastain ABC kit, Vector Laboratories). Immunoreactivity was visualized using standard DAB procedures ...
-
bioRxiv - Developmental Biology 2021Quote: ... Visualization of eRNAi clones was achieved by detecting the co-injected biotin-dextran with the Vectastain ABC-AP kit (Vector Laboratories) after ISH ...
-
bioRxiv - Cell Biology 2021Quote: ... avidin/biotin blocking was performed prior to addition of the MG-H1 antibody using the Avidin/Biotin Blocking Kit (Vector Laboratories), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... visualization of antigen-bound primary antibodies was carried out using a biotinylated secondary antibody together with the avidin-biotin system and the VECTOR peroxidase kit (PK-6100, Vector Laboratories) using both diaminobenzidine tablets (D4293 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sections were washed three times with PBST and detection was performed using Vectastain Elite ABC kit (Vector Laboratories, PK-6100) and DAB Peroxidase (HRP ...
-
bioRxiv - Bioengineering 2021Quote: ... Sections were washed in TBS and then incubated with biotinylated secondary antibodies and developed using Vector ELITE ABC kits (Vector Laboratories) and 3,3-diaminobenzidine (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... The staining was visualized by color reaction with 3,3′ diaminobenzidinetetrahydrochloride (DAB Peroxidase HRP Substrate Kit, 3,3’-diaminobenzidine; SK-4100; Vector Laboratories, Burlingame, CA) under microscopic control until optimal staining was achieved (approximately 2-5 min) ...
-
bioRxiv - Genetics 2019Quote: ... The secondary was washed with TBS and then slides were incubated with VECTASTAIN Elite ABC kit PK6100 tertiary complex (Vector Laboratories), for 30 min at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... HER-2-positive cells were visualized using rabbit IgG VECTORSTAIN ABC Elite and DAB (3,3’-diaminobenzidine) Peroxidase Substrate Kits (Vector Laboratories, UK) and visualized using a bright field microscope.
-
bioRxiv - Immunology 2019Quote: ... HER-2 and CD3-positive cells were visualized using rabbit IgG VECTORSTAIN ABC Elite and DAB (3,3’-diaminobenzidine) Peroxidase Substrate Kits (Vector Laboratories, UK) and counterstained with hematoxylin ...
-
bioRxiv - Genetics 2019Quote: ... washed in PBS and then incubated in 2.5% horse blocking serum (ImmPRESSpress anti-rabbit IgG reagent Kit, Vector Laboratories, Burlingame, CA) for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... washed with PBS and incubated in the premade ABC solution from VECTASTAIN Elite ABC HRP Kit (Vector Laboratories, cat# PK-7200) for 60 minutes ...