Labshake search
Citations for Vector Labs :
1701 - 1750 of 2350 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp120 1996 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... for 1 h and mounted using Vectorshield mounting media with DAPI (H1200, Vector Laboratories). Images were captured using a Zeiss Axio Imager microscope (Carl Zeiss GmbH ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 90 min amplification in avidin-biotin complex (ABC; Vector Lab, 1:500). Sections were then reacted in 3,3’-Diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 µl stained sample was mixed with 3 µl Vectashield mounting medium (Vector Laboratories) and mounted on a slide ...
-
bioRxiv - Neuroscience 2020Quote: ... Labeling was amplified by avidin–biotin complex (1:1000; Vector Laboratories, Burlingame, CA, USA) by incubation for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... biocytin was labeled with DyLight 594 conjugated streptavidin (1:200, Vector Labs, SA-5594) to reveal if the recorded cell was coupled or not.
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were washed for 1 hr with PBSTx and mounted in VectaShield (Vector Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... and for 1 h with Vectastain® Avidin-Biotin Complex Staining kit (Vector Laboratories). Sections were developed in a Tris buffer solution (TBS ...
-
bioRxiv - Physiology 2021Quote: ... Capillaries were visualized by staining with lectin (Biotinylated Griffonia simplifolia Lectin 1; Vector lab), followed by a Streptavidin Qdot 655 (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 4’6’-diamidino-2-phenylindole (DAPI) diluted 1:5 in Vectashield mounting media (Vector Labs) was used as a counterstain ...
-
bioRxiv - Neuroscience 2020Quote: ... (iv) 1:100 peroxidase-avidin complex (Vectastain Elite Kit, Vector Laboratories, catalog PK-6100), 30 minutes ...
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with biotin-conjugated secondary antibodies (Vector Lab, BA-9200; 1:200) and horseradish peroxidase (HRP)-conjugated streptavidin (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in avidin–biotinylated horseradish peroxidase complex (Elite ABC; 1:300; Vector Laboratories) diluted in TBS for 3 h at room temperature or overnight at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... Two 15-cm petri dish were incubated with BSL-1 (5μg/mL, Vector Labs) in D-PBS for at least 2 hours at room temperature (negative panning dishes) ...
-
Hormonal contraceptives alter amphetamine place preference and responsivity in the intact female ratbioRxiv - Animal Behavior and Cognition 2021Quote: ... primary incubation used rabbit antiserum against FOS (1:2500; Vector Laboratories, Inc., Burlingame, CA) and secondary incubation used biotinylated goat anti-rabbit IgG (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and subsequently streptavidin-conjugated horseradish peroxidase (HRP) (1:300; Vectastain ABC kit, Vector Laboratories). Immunostaining was visualized with hydrogen peroxide and 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with biotin-labeled secondary antibody (Vector Laboratories, Newark, CA, BA-2000, 1:200) was performed at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated in avidin-biotin horseradish peroxidase complex kit (1:500, Vector Laboratories) in PBS containing 0.4% Triton-X for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... Lotus Tetragonolobus Lectin (LTL)-fluorescein (1:400, FL-1321-2, Vector Laboratories, Newark, CA), goat anti-rabbit IgG Alexa Fluor 647 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and using Glu-R1 (Millipore Cat# AB1504, 1:250; Vector Laboratories, Burlingame, CA, USA) for the primary and Anti-glutamate receptor 1 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... we used ABC (avidin biotinylated horseradish peroxidase complex, 1:300, Vector Laboratories, #PK-4000) and DAB as a chromogen.
-
bioRxiv - Neuroscience 2023Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rhodamine conjugated Dolichos biflorus agglutinin (1:100, DBA, Vector Laboratories, RL-1032-2). Secondary antibodies used were goat anti-mouse AlexaFluor 647 and goat anti-rabbit AlexaFluor 488 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Physiology 2024Quote: ... biotinylated wisteria floribunda lectin (WFA, 1/2000, Vector laboratories #B-1355, Les Ulis, France) with Alexa Fluor 488 Avidin (1/1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were stained with DAB substrate (Vector Laboratories SK-4100, using reagents 1-3) for 3 min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were incubated in 1:200 FITC-PNA (Vector Laboratories, Cat# FL-1071-10) and 1:5000 DAPI (10 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Additional staining reagents included biotinylated Dolichos biflorus agglutinin (1:400; Vector Laboratories; #B-1035) and streptavidin Alexa 350 (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by a monoclonal secondary horseradish peroxidase (HRP)-coupled horse-anti-rabbit antibody (ImmPRESS Reagent Kit, MP-7401, Vector Laboratories). AEC-Plus (K3469 ...
-
bioRxiv - Neuroscience 2020Quote: ... Slices were washed three times in PBT for 5 minutes then incubated in biotinylated anti-rabbit IgG (Vectastain, Vector Laboratories) at a concentration of 1:200 in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... tissue sections were processed using ImmPRES Excel Amplified HRP Polymer Staining Kit (Anti-Rabbit IgG, MP-7601-15, Vector Laboratories) per manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... followed by a rabbit ImmPRESS HRP anti-rabbit IgG (peroxidase) polymer detection kit and Vector NovaRED substrate kit (Vector Laboratories). Images were visualized by microscopy (Zeiss Axio Observer ...
-
bioRxiv - Cancer Biology 2022Quote: The following antibodies were used for immunohistochemistry and immunofluorescence: ImmPRESS HRP Horse anti-Rabbit IgG (Vector Laboratories MP-7801-15), ImmPRESS HRP Horse anti-Mouse IgG (Vector Laboratories MP-7802-15) ...
-
bioRxiv - Neuroscience 2020Quote: ... This was washed out and replaced with ImmPRESS reagent (HRP anti-goat IgG; Vector labs, MP-7405; 2h, room temperature). Following a series of washes ...
-
bioRxiv - Immunology 2020Quote: ... Leenen) followed by detection with biotin labeled rabbit anti-rat antibody and staining with ABC kit (Vector Labs, Burlingame, CA).
-
bioRxiv - Microbiology 2021Quote: ... The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L) (Vector Laboratories, Burligame, CA, USA). For mouse derived primary antibodies ...