Labshake search
Citations for Vector Labs :
1351 - 1400 of 1911 citations for Somatostatin Receptor 1 SSTR1 Rabbit Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were treated with Antigen Unmasking Solution (1:100, SKU H-3300-250, Vector Laboratories) at 95°C for 10 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2019Quote: ... blots were first probed by 1 μg/ml biotinylated Peanut Agglutinin (PNA, Vector laboratories, USA) followed by 0.2 μg/ml HRP-streptavidin (Vector laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Dry and clean coverslips were then treated with Vectabond/acetone (1% v/v) (Vector Labs) solution for 5 min and then rinsed with water and left in a dried state until used ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with 1 μg/ml biotinylated Con A lectin (Vector Labs, Peterborough) in blocking buffer at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by washes and 1 h of amplification with an avidin-biotin complex (Vector Labs). The sections were then washed and incubated with a FITC-conjugated streptavidin (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at room temperature in PBS containing avidin-fluorescein (1:200, Vector Laboratories), 5% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (1:200, BA-9200, Vector Laboratories) for 40 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Sections were blocked for 1 h in 10% normal horse serum (Vector Laboratories, S-2000) in PBS and incubated overnight at 4°C in primary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 hour at room temperature with Carbohydrate-Free blocking solution (Vector Labs), and treated with 0.005 U of neuraminidase from C ...
-
bioRxiv - Pathology 2022Quote: The human vessels were labelled using Dylight755-conjugated UEA-1 lectin (100 μg, Vector Laboratories), platelets using DyLight488-anti-mouse GPIbβ antibody (0.1 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... Elite Avidin-Biotin Complex (eABC, 1:300, Vector Laboratories: PK-6100, RRID: AB_2336819; 1.5h, RT) and streptavidin conjugated fluorescent antibodies (SA-A488 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Other reagents used were Fluorescein Griffonia simplicifolia-Lectin I (Isolectin B4; 1:250; Vector Laboratories; Burlingame ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... were applied for 1 h and then incubated with ABC (Vectastain, Vector Laboratories #PK-6100) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by the avidin-biotin-peroxidase complex (ABC Elite; 1:200; Vector laboratories, Burlingame, USA) in 0.1 M PBS for 2 hr at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... rinsed in PBS and incubated 1 hour with the Vectasatin ABC Kit (Vector Laboratories, PK7200). Revelation was performed by incubating the sections in 0.075% 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were exposed to Wisteria Floribunda Lectin (WFA; Vector labs, FL-1351; 1:500 dilution) for 24 hours at the end of the protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were washed and incubated with the appropriate biotinylated secondary antibodies (1:1,000, Vector laboratories), followed by washing and visualization using Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... and then for 1 h in Vectastain ABC reagent (Cat. no. PK-6100, Vector Laboratories). Staining was developed using 0.05% DAB (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by the incubation with 1 μg/mL biotinylated VVA lectin (Vector Labs, CA, USA)1 h at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... and donkey anti–mouse DyLight 594 (1:700; catalog #DK-2594, Vector Laboratories, Burlingame, CA) antibodies in 0.1 M PBS for 3 hours at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then incubated in the avidin-biotin complex (1:1000, PK-6100, Vector Laboratories) and followed by 0.04% 3 ...
-
bioRxiv - Physiology 2022Quote: ... a 1:200 dilution of goat biotinylated anti-mouse antibody (Vector Labs, Burlington, ON, Canada) in antibody diluent (DAKO ...
-
bioRxiv - Microbiology 2019Quote: ... in vitro cysts were fixed and stained with biotinylated dolichos (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Microbiology 2019Quote: ... in vitro cysts were fixed and stained with biotinylated dolichos (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were then fixed and stained with biotinylated dolichos lectin (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were incubated in mouse on mouse blocking reagent (1:250 in TBS; Vector Labs) for 1 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... Organoids were blocked for 1 hr in IF buffer with 10% goat serum (Vector Laboratories). Primary antibody made up in blocking buffer was incubated in the chambers overnight at 4°C in a humidified chamber ...
-
bioRxiv - Microbiology 2019Quote: ... Sections were then incubated with biotinylated Dolichos biflorus agglutinin (DBA) (Vector Laboratories 1031, 1:500), which binds to the cyst wall (64–66) ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were incubated in a solution containing normal donkey serum (NDS, 1:30; Vector Laboratory) diluted in KPBS with 0.3% Triton-X100 ...
-
bioRxiv - Developmental Biology 2019Quote: ... a 1:100 dilution of goat biotinylated anti-mouse antibody (Vector Labs, Burlington, ON, Canada) in antibody diluent (DAKO ...
-
bioRxiv - Neuroscience 2020Quote: ... then incubated in 1% avidin-biotinylated horseradish peroxidase (Vector ABC staining kit, Vector Lab. Inc.) containing 0.1% Triton X-100 for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... for 1 h at room temperature and visualization in 3,3’-diaminobenzidine tetrahydrochloride (DAB; Vector Labs), sections were mounted on Superfrost plus slides (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... rinsed in PBS and incubated 1 hour with the Vectasatin ABC Kit (Vector Laboratories, PK7200).
-
bioRxiv - Bioengineering 2019Quote: ... Cy3- and Cy5-conjugated secondary antibodies were used at 1:400 (Vector Laboratories, Burlington, CA).
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed again and incubated with streptavidin-HRP (1:3000; Vector Laboratories SA-5004) in permeabilization buffer for 30 min at room temperature ...
-
bioRxiv - Genetics 2020Quote: ... Slide were mounted in Vectashield mounting medium with DAPI (1.5 μg.ml−1; Vector Laboratories Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... at RT for 1 h followed by staining with DAPI (Vector Laboratories, H-1800-2). Images were acquired with Leica DMi8 microscope.
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated for 3 h in biotinylated horse anti-goat (1:200, Vector Labs) or biotinylated goat anti-rabbit secondary antibody (1:200 ...