Labshake search
Citations for Vector Labs :
1201 - 1250 of 1955 citations for 1 tert Butoxy 4 methyl 2 nitrobenzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Horse anti-rabbit biotinylated IgG (1:400; VC-BA-1100-MM15; Vector Laboratories; IF), streptavidin Alexa Fluor 555 conjugate (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were treated with biotinylated donkey-anti-mouse IgG (1:300; Vector Laboratories) for 2 h ...
-
bioRxiv - Physiology 2022Quote: ... 1:1000 and secondary ImmPRESS HRP Goat Anti-Rat IgG (Vector Laboratories, Burlingame, California) to assess the macrophage content of type III lesions.
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated in avidin-biotin horseradish peroxidase complex kit (1:500, Vector Laboratories) in PBS containing 0.4% Triton-X for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... The secondary antibody used was peroxidase-labelled anti-rabbit IgG (1:5000, Vector Laboratories). SuperSignal West Femto ECL (Pierce ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... and using Glu-R1 (Millipore Cat# AB1504, 1:250; Vector Laboratories, Burlingame, CA, USA) for the primary and Anti-glutamate receptor 1 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... and biotinylated goat anti-rabbit IgG antibody (1:200, Vector Labs, BA-1000-1.5), and revealed by ABC kit (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used ABC (avidin biotinylated horseradish peroxidase complex, 1:300, Vector Laboratories, #PK-4000) and DAB as a chromogen.
-
bioRxiv - Neuroscience 2023Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were incubated in 1:200 FITC-PNA (Vector Laboratories, Cat# FL-1071-10) and 1:5000 DAPI (10 mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... 150 µl of a 1/200 dilution biotinylated anti-mouse antibody (Vector Laboratories, USA) was added for 30 minutes at room temperature in a humid chamber ...
-
bioRxiv - Neuroscience 2024Quote: ... Philippe Ciofi) followed by biotinylated goat anti-guinea pig IgG (1:1,000, Vector Laboratories) and DyLight Streptavidin 488 (1:500 ...
-
bioRxiv - Physiology 2024Quote: ... biotinylated wisteria floribunda lectin (WFA, 1/2000, Vector laboratories #B-1355, Les Ulis, France) with Alexa Fluor 488 Avidin (1/1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were stained with DAB substrate (Vector Laboratories SK-4100, using reagents 1-3) for 3 min at room temperature ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and probed for 1 h with fluorescein-labeled SBA (Vector Laboratories, Cat # FL-1011) and Alexa Fluor 647 (AF647)-conjugated anti-His antibody (R&D Systems ...
-
bioRxiv - Neuroscience 2024Quote: ... then transferred to an avidin–biotin complex for 1 h (Vector Laboratories, PK-6200) and developed using diaminobenzidine (DAB ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining with fluorescein isothiocyanate (FITC) conjugated streptavidin (#SA-5001-1, Vector Laboratories) for 15 min on ice ...
-
bioRxiv - Neuroscience 2024Quote: ... 290 – 305 mOsm) was supplemented with 1 mg/ml neurobiotin (Vector Labs, Servion, Switzerland) and used for measurements of active and passive properties and all current clamp recordings ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 mg of DyLight649-labelled Lycopersicon Esculentum (tomato) lectin (Vector Laboratories, DL-1178-1) was injected intravenously through the tail vein in a volume of 0.1 ml just prior to euthanasia and dissection ...
-
bioRxiv - Microbiology 2024Quote: ... Additional staining reagents included biotinylated Dolichos biflorus agglutinin (1:400; Vector Laboratories; #B-1035) and streptavidin Alexa 350 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Immunology 2024Quote: ... followed by 1-hour incubation with avidin-biotin-peroxidase complex (Vectorstain, ABCkit, Vector Laboratories) in KPBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Secondary antibodies used were biotinylated anti-rabbit and anti-mouse (1:2000, Vector Lab.). The Vectastain ABC kit and DAB peroxidase substrate (Vector Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by Goat anti-rabbit IgG (H+L) (Vector Laboratories, BA-1000; 1:200) for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 1 hour and mounted with VECTASHIELD PLUS Antifade Mounting Medium (Vector Laboratories H1900). Slides were imaged on the Zeiss LSM880 inverted confocal microscope and images were processed using FIJI v1.53.
-
bioRxiv - Biochemistry 2024Quote: ... goat anti-rabbit IgG (H+L) HRP (Vector Laboratories, PI-1000, dilution 1:5000), Sheep anti-mouse IgG (H+L ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were incubated for 2h with biotinylated anti-rabbit IgG (1:200, Vector Laboratories), washed again ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell membranes were stained with wheat germ agglutinin (WGA Rhodamine, 1:100, Vector Laboratories). Cell nuclei were stained with DAPI (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were treated with Antigen Unmasking Solution (1:100, SKU H-3300-250, Vector Laboratories) at 95°C for 10 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the slides were incubated with 1:500 biotin-conjugated ant-rabbit (BA-1000 Vector laboratories), anti-goat (BA-9500 Vector laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Dry and clean coverslips were then treated with Vectabond/acetone (1% v/v) (Vector Labs) solution for 5 min and then rinsed with water and left in a dried state until used ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with 1 μg/ml biotinylated Con A lectin (Vector Labs, Peterborough) in blocking buffer at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by washes and 1 h of amplification with an avidin-biotin complex (Vector Labs). The sections were then washed and incubated with a FITC-conjugated streptavidin (1:400 ...