Labshake search
Citations for Vector Labs :
1101 - 1150 of 2375 citations for 8 11 Methano 10a 3 6a 1 propanyl 3 ylidene 8H indeno 2 1 b azocine 12 14 dione 5 acetyloxy 4 benzoyloxy dodecahydro 1 3 dimethyl 9 methylene 3R 4S 5R 6aR 6bR 8S 10aR 11R 11aS 15S 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Biochemistry 2023Quote: ... 15 μL of mounting medium (Vector Laboratories) was added followed by a coverslip ...
-
bioRxiv - Pathology 2021Quote: ... 4µm paraffin sections were incubated with antigen retrieval citrate-based solution pH=9 (Vector Laboratories) at 95°C for 15 min ...
-
bioRxiv - Pathology 2023Quote: ... rehydrated and antigen unmasking was realized with pH 9 Tris solution (H-3301, Vector Laboratories) 5 min three times in a microwave ...
-
bioRxiv - Neuroscience 2023Quote: ... 9 µg of succinylated Wheat Germ Agglutinin (sWGA)-bound agarose beads (Vector Laboratories, Burlingame, CA) and mitochondrial lysates were incubated for 12hr at 4 ºC for O-GlcNAcylated protein enrichment ...
-
bioRxiv - Immunology 2022Quote: ... The cells were washed and stained for 30 min at 4°C with 5 μg/ml FITC- WGA (Vector Laboratories). After the wash ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were mounted in Vectashield® mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories, Burlingame, CA). Fluorescent staining was visualized using a Nikon E800 fluorescent microscope and images were captured using NIS-Elements (Nikon Instrument Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The slides were covered with Vectashield medium containing 4′,6-diamidino-2-phenylindole (DAPI; Vector Laboratories, H- 1200-10) for nuclei staining and then mounted with a glass coverslip ...
-
bioRxiv - Cancer Biology 2019Quote: ... we mounted cells on microscope slides with 4’,6’-diamidino-2-phenylindole (DAPI)-containing Vectashield mounting solution (Vector Laboratories) for detection of fluorescence with an EVOS FL fluorescence microscope (ThermoFisher).
-
bioRxiv - Neuroscience 2019Quote: ... coverslipped with Vectashield HardSet Mounting Medium with DAPI (4′,6-diamidino-2-phenylindole; nuclear counterstain; H-1500, Vector Labs), and stored at 4°C.
-
bioRxiv - Cell Biology 2022Quote: ... The sections were then co-stained with 4′,6-diamidino-2-phenylindole (H-1200, DAPI, Vector Laboratories, Burlingame, CA). The sample images were captured by a confocal microscope (Zeiss LSM 780) ...
-
bioRxiv - Cancer Biology 2019Quote: ... we mounted cells on microscope slides with 4’,6’-diamidino-2-phenylindole (DAPI)-containing Vectashield mounting solution (Vector Laboratories). For fluorescence detection ...
-
bioRxiv - Molecular Biology 2020Quote: ... Vectashield antifade mounting medium with 4’,6-diamidino-2-phenylindole (DAPI) was obtained from Vector Laboratories (Burlingame, CA, USA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were mounted with a mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, California, USA), which stained nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... then mounted with Vectashield Antifade Mounting Medium with DAPI (4′,6-diamidino-2-phenylindole) (Vector Laboratories, Burlingame, California, USA) and sealed ...
-
bioRxiv - Genetics 2023Quote: ... the slides with chromosome spreads were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Vector Laboratories, Burlingame, CA, USA) solution ...
-
bioRxiv - Cell Biology 2024Quote: ... samples were mounted with Mounting Medium with 4’,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Cat# H-1200-10). Paraffin embedded liver sections (3 μm ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the slides were stained and mounted in Vectashield Antifade Medium containing 4’,6-diamidino-2-phenylindole (DAPI; Vector Laboratories).
-
bioRxiv - Developmental Biology 2020Quote: ... or biotinylated Wheat Germ Agglutinin (WGA, Vector Laboratories, #B-1025) at 1:1000 dilution in TBST 2.5 hr at RT ...
-
bioRxiv - Genomics 2022Quote: ... and biotinylated Lotus Tetragonolobus Lectin (LTL) (Vector Laboratories, B-1325) at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were treated with Antigen Unmasking Solution (1:100, SKU H-3300-250, Vector Laboratories) at 95°C for 10 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the slides were incubated with 1:500 biotin-conjugated ant-rabbit (BA-1000 Vector laboratories), anti-goat (BA-9500 Vector laboratories ...
-
bioRxiv - Pathology 2019Quote: ... blots were first probed by 1 μg/ml biotinylated Peanut Agglutinin (PNA, Vector laboratories, USA) followed by 0.2 μg/ml HRP-streptavidin (Vector laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Dry and clean coverslips were then treated with Vectabond/acetone (1% v/v) (Vector Labs) solution for 5 min and then rinsed with water and left in a dried state until used ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with 1 μg/ml biotinylated Con A lectin (Vector Labs, Peterborough) in blocking buffer at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by washes and 1 h of amplification with an avidin-biotin complex (Vector Labs). The sections were then washed and incubated with a FITC-conjugated streptavidin (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at room temperature in PBS containing avidin-fluorescein (1:200, Vector Laboratories), 5% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (1:200, BA-9200, Vector Laboratories) for 40 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Sections were blocked for 1 h in 10% normal horse serum (Vector Laboratories, S-2000) in PBS and incubated overnight at 4°C in primary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 hour at room temperature with Carbohydrate-Free blocking solution (Vector Labs), and treated with 0.005 U of neuraminidase from C ...
-
bioRxiv - Pathology 2022Quote: The human vessels were labelled using Dylight755-conjugated UEA-1 lectin (100 μg, Vector Laboratories), platelets using DyLight488-anti-mouse GPIbβ antibody (0.1 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... Elite Avidin-Biotin Complex (eABC, 1:300, Vector Laboratories: PK-6100, RRID: AB_2336819; 1.5h, RT) and streptavidin conjugated fluorescent antibodies (SA-A488 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Other reagents used were Fluorescein Griffonia simplicifolia-Lectin I (Isolectin B4; 1:250; Vector Laboratories; Burlingame ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... were applied for 1 h and then incubated with ABC (Vectastain, Vector Laboratories #PK-6100) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by the avidin-biotin-peroxidase complex (ABC Elite; 1:200; Vector laboratories, Burlingame, USA) in 0.1 M PBS for 2 hr at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... rinsed in PBS and incubated 1 hour with the Vectasatin ABC Kit (Vector Laboratories, PK7200). Revelation was performed by incubating the sections in 0.075% 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were exposed to Wisteria Floribunda Lectin (WFA; Vector labs, FL-1351; 1:500 dilution) for 24 hours at the end of the protocol ...