Labshake search
Citations for Vector Labs :
1101 - 1150 of 1890 citations for 6 Cyano imidazo 1 2 a pyridine 2 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Two 15-cm petri dish were incubated with BSL-1 (5μg/mL, Vector Labs) in D-PBS for at least 2 hours at room temperature (negative panning dishes) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
Hormonal contraceptives alter amphetamine place preference and responsivity in the intact female ratbioRxiv - Animal Behavior and Cognition 2021Quote: ... primary incubation used rabbit antiserum against FOS (1:2500; Vector Laboratories, Inc., Burlingame, CA) and secondary incubation used biotinylated goat anti-rabbit IgG (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and subsequently streptavidin-conjugated horseradish peroxidase (HRP) (1:300; Vectastain ABC kit, Vector Laboratories). Immunostaining was visualized with hydrogen peroxide and 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2019Quote: ... or biotinylated goat anti-rabbit/mouse IgG antibody (1:1000, BA-1000, Vector Laboratories) in PBS-BX for 2 hours at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... The secondary antibody (goat anti-rabbit bioninylated, 1:200, Vector laboratories Cat # BA-1000) was incubated for 1 hour at room temperature followed by a 30-minute incubation with Avidin-Biotin complex (ABC kit ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were detected by biotinylated anti-rabbit (BA-1000; 1:500; Vector Laboratories). Fluorescein-conjugated avidin D (A-2001 ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with biotin-labeled secondary antibody (Vector Laboratories, Newark, CA, BA-2000, 1:200) was performed at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... Horse anti-rabbit biotinylated IgG (1:400; VC-BA-1100-MM15; Vector Laboratories; IF), streptavidin Alexa Fluor 555 conjugate (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were treated with biotinylated donkey-anti-mouse IgG (1:300; Vector Laboratories) for 2 h ...
-
bioRxiv - Physiology 2022Quote: ... 1:1000 and secondary ImmPRESS HRP Goat Anti-Rat IgG (Vector Laboratories, Burlingame, California) to assess the macrophage content of type III lesions.
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated in avidin-biotin horseradish peroxidase complex kit (1:500, Vector Laboratories) in PBS containing 0.4% Triton-X for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... The secondary antibody used was peroxidase-labelled anti-rabbit IgG (1:5000, Vector Laboratories). SuperSignal West Femto ECL (Pierce ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Neuroscience 2023Quote: ... and biotinylated goat anti-rabbit IgG antibody (1:200, Vector Labs, BA-1000-1.5), and revealed by ABC kit (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... and using Glu-R1 (Millipore Cat# AB1504, 1:250; Vector Laboratories, Burlingame, CA, USA) for the primary and Anti-glutamate receptor 1 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... we used ABC (avidin biotinylated horseradish peroxidase complex, 1:300, Vector Laboratories, #PK-4000) and DAB as a chromogen.
-
bioRxiv - Neuroscience 2023Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Physiology 2024Quote: ... biotinylated wisteria floribunda lectin (WFA, 1/2000, Vector laboratories #B-1355, Les Ulis, France) with Alexa Fluor 488 Avidin (1/1000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were stained with DAB substrate (Vector Laboratories SK-4100, using reagents 1-3) for 3 min at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were incubated in 1:200 FITC-PNA (Vector Laboratories, Cat# FL-1071-10) and 1:5000 DAPI (10 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Additional staining reagents included biotinylated Dolichos biflorus agglutinin (1:400; Vector Laboratories; #B-1035) and streptavidin Alexa 350 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Neuroscience 2024Quote: ... Philippe Ciofi) followed by biotinylated goat anti-guinea pig IgG (1:1,000, Vector Laboratories) and DyLight Streptavidin 488 (1:500 ...
-
bioRxiv - Immunology 2024Quote: ... 150 µl of a 1/200 dilution biotinylated anti-mouse antibody (Vector Laboratories, USA) was added for 30 minutes at room temperature in a humid chamber ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were treated with Antigen Unmasking Solution (1:100, SKU H-3300-250, Vector Laboratories) at 95°C for 10 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the slides were incubated with 1:500 biotin-conjugated ant-rabbit (BA-1000 Vector laboratories), anti-goat (BA-9500 Vector laboratories ...
-
bioRxiv - Pathology 2019Quote: ... blots were first probed by 1 μg/ml biotinylated Peanut Agglutinin (PNA, Vector laboratories, USA) followed by 0.2 μg/ml HRP-streptavidin (Vector laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Dry and clean coverslips were then treated with Vectabond/acetone (1% v/v) (Vector Labs) solution for 5 min and then rinsed with water and left in a dried state until used ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with 1 μg/ml biotinylated Con A lectin (Vector Labs, Peterborough) in blocking buffer at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by washes and 1 h of amplification with an avidin-biotin complex (Vector Labs). The sections were then washed and incubated with a FITC-conjugated streptavidin (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at room temperature in PBS containing avidin-fluorescein (1:200, Vector Laboratories), 5% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (1:200, BA-9200, Vector Laboratories) for 40 minutes at room temperature ...