Labshake search
Citations for Vector Labs :
1001 - 1050 of 2206 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were washed for 1 hr with PBSTx and mounted in VectaShield (Vector Laboratories).
-
bioRxiv - Developmental Biology 2021Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: ... and for 1 h with Vectastain® Avidin-Biotin Complex Staining kit (Vector Laboratories). Sections were developed in a Tris buffer solution (TBS ...
-
bioRxiv - Pathology 2020Quote: ... and incubated with biotinylated goat anti-mouse IgG (1:1000; Vector Laboratories, CA, USA) or biotinylated goat anti-rabbit IgG (1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... Capillaries were visualized by staining with lectin (Biotinylated Griffonia simplifolia Lectin 1; Vector lab), followed by a Streptavidin Qdot 655 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... (iv) 1:100 peroxidase-avidin complex (Vectastain Elite Kit, Vector Laboratories, catalog PK-6100), 30 minutes ...
-
bioRxiv - Genetics 2020Quote: ... Biotinylated secondary antibodies: goat anti-rabbit and horse anti-goat (1:200, Vector Labs).
-
bioRxiv - Physiology 2020Quote: ... followed by incubation with biotin-conjugated secondary antibodies (Vector Lab, BA-9200; 1:200) and horseradish peroxidase (HRP)-conjugated streptavidin (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in avidin–biotinylated horseradish peroxidase complex (Elite ABC; 1:300; Vector Laboratories) diluted in TBS for 3 h at room temperature or overnight at 4 °C ...
-
bioRxiv - Zoology 2021Quote: ... and biotinylated goat anti-rabbit IgG (BA1000, VECTOR Laboratories, Burlingame, CA, USA; 1:500) for 1 day at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Two 15-cm petri dish were incubated with BSL-1 (5μg/mL, Vector Labs) in D-PBS for at least 2 hours at room temperature (negative panning dishes) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Vectastain A and B and Biotinylated donkey anti Rabbit IgG (1:200, Vector Labs). Tracheal preparations were flat-mounted in ProLong Diamond Antifade Mountant with DAPI (Molecular Probes ...
-
Hormonal contraceptives alter amphetamine place preference and responsivity in the intact female ratbioRxiv - Animal Behavior and Cognition 2021Quote: ... primary incubation used rabbit antiserum against FOS (1:2500; Vector Laboratories, Inc., Burlingame, CA) and secondary incubation used biotinylated goat anti-rabbit IgG (1:250 ...
-
bioRxiv - Neuroscience 2020Quote: ... and subsequently streptavidin-conjugated horseradish peroxidase (HRP) (1:300; Vectastain ABC kit, Vector Laboratories). Immunostaining was visualized with hydrogen peroxide and 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Developmental Biology 2020Quote: ... The secondary antibody (goat anti-rabbit bioninylated, 1:200, Vector laboratories Cat # BA-1000) was incubated for 1 hour at room temperature followed by a 30-minute incubation with Avidin-Biotin complex (ABC kit ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... Lotus Tetragonolobus Lectin (LTL)-fluorescein (1:400, FL-1321-2, Vector Laboratories, Newark, CA), goat anti-rabbit IgG Alexa Fluor 647 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and biotinylated goat anti-rabbit IgG antibody (1:200, Vector Labs, BA-1000-1.5), and revealed by ABC kit (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... and using Glu-R1 (Millipore Cat# AB1504, 1:250; Vector Laboratories, Burlingame, CA, USA) for the primary and Anti-glutamate receptor 1 (rabbit polyclonal ...
-
bioRxiv - Neuroscience 2023Quote: ... we used ABC (avidin biotinylated horseradish peroxidase complex, 1:300, Vector Laboratories, #PK-4000) and DAB as a chromogen.
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rhodamine conjugated Dolichos biflorus agglutinin (1:100, DBA, Vector Laboratories, RL-1032-2). Secondary antibodies used were goat anti-mouse AlexaFluor 647 and goat anti-rabbit AlexaFluor 488 (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... The secondary antibody used was peroxidase-labelled anti-rabbit IgG (1:5000, Vector Laboratories). SuperSignal West Femto ECL (Pierce ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Cell Biology 2022Quote: ... Primary antibodies were detected by biotinylated anti-rabbit (BA-1000; 1:500; Vector Laboratories). Fluorescein-conjugated avidin D (A-2001 ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with biotin-labeled secondary antibody (Vector Laboratories, Newark, CA, BA-2000, 1:200) was performed at room temperature for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... Horse anti-rabbit biotinylated IgG (1:400; VC-BA-1100-MM15; Vector Laboratories; IF), streptavidin Alexa Fluor 555 conjugate (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were treated with biotinylated donkey-anti-mouse IgG (1:300; Vector Laboratories) for 2 h ...
-
bioRxiv - Physiology 2022Quote: ... 1:1000 and secondary ImmPRESS HRP Goat Anti-Rat IgG (Vector Laboratories, Burlingame, California) to assess the macrophage content of type III lesions.
-
bioRxiv - Neuroscience 2023Quote: ... Sections were incubated in avidin-biotin horseradish peroxidase complex kit (1:500, Vector Laboratories) in PBS containing 0.4% Triton-X for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Physiology 2024Quote: ... biotinylated wisteria floribunda lectin (WFA, 1/2000, Vector laboratories #B-1355, Les Ulis, France) with Alexa Fluor 488 Avidin (1/1000 ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were incubated in 1:200 FITC-PNA (Vector Laboratories, Cat# FL-1071-10) and 1:5000 DAPI (10 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Additional staining reagents included biotinylated Dolichos biflorus agglutinin (1:400; Vector Laboratories; #B-1035) and streptavidin Alexa 350 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and probed for 1 h with fluorescein-labeled SBA (Vector Laboratories, Cat # FL-1011) and Alexa Fluor 647 (AF647)-conjugated anti-His antibody (R&D Systems ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining with fluorescein isothiocyanate (FITC) conjugated streptavidin (#SA-5001-1, Vector Laboratories) for 15 min on ice ...
-
bioRxiv - Immunology 2024Quote: ... followed by 1-hour incubation with avidin-biotin-peroxidase complex (Vectorstain, ABCkit, Vector Laboratories) in KPBS ...