Labshake search
Citations for Vector Labs :
801 - 850 of 1566 citations for 6 Chloro 1 benzofuran 7 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Blocking for 1 h with 5% (vol/vol) normal goat serum (NGS, Vector Laboratories) was followed by incubation with the appropriate primary antibody at 4°C for 48 h in 2% (vol/vol ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue was transferred to an avidin-biotin complex (Elite kit; 1:1000, Vector Laboratories) for 4 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rhodamine conjugated Dolichos biflorus agglutinin (1:100, DBA, Vector Laboratories, RL-1032-2). Secondary antibodies used were goat anti-mouse AlexaFluor 647 and goat anti-rabbit AlexaFluor 488 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... PNNs were labeled with biotinylated WFA (1:100, B-1355, Vector Laboratories, Burlingame, USA). Glutamatergic and GABAergic synaptic terminals were detected using guinea pig anti-VGLUT1 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... vasculature was labeled by DyLight Tomato Lectin 649 (Vector Laboratories, Cat# DL-1178-1). EdU detection was performed with the Click-iT Plus EdU Alexa Fluor 647 Imaging Kit (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with peroxidase-avidin-biotin complex (ABC 1: 200, Vector Labs) for 120 min and then were exposed to diaminobenzidine (DAB ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were incubated with biotinylated goat anti-rabbit IgG (1:200; Vector Laboratories Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with the avidin-biotin peroxidase complex (ABC) (1:300; Vector Laboratories, Burlingame ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated 1:500 with Streptavidin Alexa Fluor™ 647 Conjugate (Vector Laboratories) overnight at 4°C in 1xPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% neurobiotin was added to the electrode solution in some experiments (Vector Laboratories, USA). To deliver neurobiotin into the neurons 500 ms positive current pulses at 2 Hz frequency were applied during the last 10 minutes of the recording ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in biotinylated goat antirabbit secondary antibody (1:1000: Vector Laboratories BA-1000) overnight in PBSTx and 1% NGS ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1:100 Avidin+Biotin-HRP (horseradish peroxidase) complex (Vector labs) in 0.1M PB at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-lotus tetragonolobus lectin (LTL; 1:500; B-1325, Vector Laboratories, Inc., CA, USA), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by peroxidase-conjugated horse anti-mouse IgG (1:10000, # PI-2000, Vector Laboratories) and imaged as described above ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 μL/mL DyLight594-conjugated Ulex Europeas agglutinin I (UEA-1, Vector Laboratories) to specifically label endothelial cells.46 The staining cocktail was prepared in 1X PBS with 0.2 % Triton-X and 1% BSA ...
-
bioRxiv - Neuroscience 2024Quote: ... After 1h at RT in horseradish streptavidin-peroxidase (1:500; SA-5004; Vector Laboratories), the final reaction was visualized by incubating the sections with a DAB kit (SK-4100 ...
-
bioRxiv - Neuroscience 2024Quote: ... HRP-conjugated secondary antibodies were used at a concentration of 1:5,000 (Vector Laboratories). For PrPC blots ...
-
bioRxiv - Cancer Biology 2023Quote: ... ATCTTCACTGAGTAGCCATCG) The lentiviral shJMJD6 and shControl (pLKO.1) particles were packaged by Vector Lab at St Jude ...
-
bioRxiv - Developmental Biology 2024Quote: ... slides were places in a 1:100 dilution of Antigen Unmasking Solution (Vector Laboratories) and heated in a boiling bath for 20 minutes and then left to sit at room temperature until solution cooled ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were counterstained with DAPI (1 μg/ml) and mounted using Vectashield (Vector Labs). Images were acquired with a Zeiss Axio Imager Fluorescence Microscope ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were treated with Antigen Unmasking Solution (1:100, SKU H-3300-250, Vector Laboratories) at 95°C for 10 minutes according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... the slides were incubated with 1:500 biotin-conjugated ant-rabbit (BA-1000 Vector laboratories), anti-goat (BA-9500 Vector laboratories ...
-
bioRxiv - Pathology 2019Quote: ... blots were first probed by 1 μg/ml biotinylated Peanut Agglutinin (PNA, Vector laboratories, USA) followed by 0.2 μg/ml HRP-streptavidin (Vector laboratories ...
-
bioRxiv - Biophysics 2021Quote: ... Dry and clean coverslips were then treated with Vectabond/acetone (1% v/v) (Vector Labs) solution for 5 min and then rinsed with water and left in a dried state until used ...
-
bioRxiv - Biochemistry 2020Quote: ... the membrane was incubated with 1 μg/ml biotinylated Con A lectin (Vector Labs, Peterborough) in blocking buffer at room temperature for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by washes and 1 h of amplification with an avidin-biotin complex (Vector Labs). The sections were then washed and incubated with a FITC-conjugated streptavidin (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated overnight at room temperature in PBS containing avidin-fluorescein (1:200, Vector Laboratories), 5% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (1:200, BA-9200, Vector Laboratories) for 40 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Sections were blocked for 1 h in 10% normal horse serum (Vector Laboratories, S-2000) in PBS and incubated overnight at 4°C in primary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 hour at room temperature with Carbohydrate-Free blocking solution (Vector Labs), and treated with 0.005 U of neuraminidase from C ...
-
bioRxiv - Pathology 2022Quote: The human vessels were labelled using Dylight755-conjugated UEA-1 lectin (100 μg, Vector Laboratories), platelets using DyLight488-anti-mouse GPIbβ antibody (0.1 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... Elite Avidin-Biotin Complex (eABC, 1:300, Vector Laboratories: PK-6100, RRID: AB_2336819; 1.5h, RT) and streptavidin conjugated fluorescent antibodies (SA-A488 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Other reagents used were Fluorescein Griffonia simplicifolia-Lectin I (Isolectin B4; 1:250; Vector Laboratories; Burlingame ...
-
Hypoxia-mediated suppression of pyruvate carboxylase drives tumor microenvironment immunosuppressionbioRxiv - Cancer Biology 2022Quote: ... were applied for 1 h and then incubated with ABC (Vectastain, Vector Laboratories #PK-6100) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by the avidin-biotin-peroxidase complex (ABC Elite; 1:200; Vector laboratories, Burlingame, USA) in 0.1 M PBS for 2 hr at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... rinsed in PBS and incubated 1 hour with the Vectasatin ABC Kit (Vector Laboratories, PK7200). Revelation was performed by incubating the sections in 0.075% 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were exposed to Wisteria Floribunda Lectin (WFA; Vector labs, FL-1351; 1:500 dilution) for 24 hours at the end of the protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sections were washed and incubated with the appropriate biotinylated secondary antibodies (1:1,000, Vector laboratories), followed by washing and visualization using Vectastain ABC kit (Vector Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... and then for 1 h in Vectastain ABC reagent (Cat. no. PK-6100, Vector Laboratories). Staining was developed using 0.05% DAB (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by the incubation with 1 μg/mL biotinylated VVA lectin (Vector Labs, CA, USA)1 h at RT ...
-
bioRxiv - Microbiology 2022Quote: ... at a dilution of 1:30,000 followed by goat anti-rabbit secondary (Vector Labs #BA1000). Signal was developed with ImmPact NovaRED HRP substrate (Vector Labs # SK-4805).
-
bioRxiv - Neuroscience 2022Quote: ... sections were stained with primary (1:1000, rabbit anti-PHA-L, Vector Laboratories AS-2300) and secondary antibodies (1:400 ...
-
bioRxiv - Neuroscience 2022Quote: ... and donkey anti–mouse DyLight 594 (1:700; catalog #DK-2594, Vector Laboratories, Burlingame, CA) antibodies in 0.1 M PBS for 3 hours at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then incubated in the avidin-biotin complex (1:1000, PK-6100, Vector Laboratories) and followed by 0.04% 3 ...
-
bioRxiv - Physiology 2022Quote: ... a 1:200 dilution of goat biotinylated anti-mouse antibody (Vector Labs, Burlington, ON, Canada) in antibody diluent (DAKO ...
-
bioRxiv - Microbiology 2019Quote: ... in vitro cysts were fixed and stained with biotinylated dolichos (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Microbiology 2019Quote: ... in vitro cysts were fixed and stained with biotinylated dolichos (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were then fixed and stained with biotinylated dolichos lectin (primary; 1:400; Vector Laboratories) and Streptavidin Alexa350 (secondary ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were incubated in mouse on mouse blocking reagent (1:250 in TBS; Vector Labs) for 1 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... Organoids were blocked for 1 hr in IF buffer with 10% goat serum (Vector Laboratories). Primary antibody made up in blocking buffer was incubated in the chambers overnight at 4°C in a humidified chamber ...