Labshake search
Citations for PerkinElmer :
301 - 350 of 898 citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence (λex = 525 nm; λem = 590 nm) was measured 3 h later in an Enspire Plate Reader (Perkin Elmer). For Nalm6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Oocytes were lysed with 1M NaOH and 1%SDS before the addition of 3 mL scintillant (Optiphase HisSafe, PerkinElmer), and l-[3H]glutamate transport was measured using a MicroBeta TriLux scintillation counter (PerkinElmer).
-
bioRxiv - Cancer Biology 2019Quote: ... After surgery, a 60 minutes continuous infusion (0.83 µl/minute, 1.2 µCi/h) of D-[3-3H]-glucose (Perkin Elmer) was administrated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were washed 3 times in PBS and incubated with tyramide Cy3 1:150 in amplification buffer (Perkin Elmer) for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2020Quote: Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
bioRxiv - Microbiology 2019Quote: ... The conversion of NAD to NADH was monitored for every10s spectrometrically by Victor 3 multimode reader (Perkin Elmer, USA) at 450 nm.
-
bioRxiv - Physiology 2021Quote: ... where whole-body glucose flux was traced by infusion of 0.05 μCi/min D-[3-3H]-glucose (Perkin Elmer), after a priming 5 μCi bolus for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... plasma solution at a rate of 0.18 ml/h for 90 min in parallel with a primed-continuous tracer D-[3-3H]-Glucose infusion (PerkinElmer, Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... [14C]-tetraethylammonium specific activity= 3.5 mCi/mmol) and [3H]-estrone 3-sulfate specific activity= 49.19 Ci/mmol) were purchased from Perkin Elmer. [3H]-phenylalanine (specific activity= 100 Ci/mmol) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were then rinsed in TBST 3 times and treated with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA). Membranes were exposed to GE Healthcare Hyperfilm ECL (28906839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dehydrated coverslips were overlaid with 0.3 μg/ml TAMRA–OO-(CCCTAA)3 or 0.3 μg/mL Alexa 488–OO-(CCCTAA)3 telomeric PNA probe (Panagene) in PNA hybridization solution (70% deionized formamide, 0.25% (v/v) NEN blocking reagent (PerkinElmer), 10 mM Tris–HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Microbiology 2023Quote: ... Zn2+ and Mn2+ amounts were calculated from standard curves made with Pure Plus Multi-Element Calibration Standard 3 (0.5-100ppb, PerkinElmer). Metals amounts detected in the 30% HNO3 blank were subtracted from all samples ...
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were washed 3 times with wash buffer (PBS + 1 mM CaCl2 + 0.1% BSA) before adding Microscint-20 (PerkinElmer) for tritium concentration measurement using a TriLux MicroBeta2 plate reader (PerkinElmer) ...
-
bioRxiv - Systems Biology 2023Quote: ... The NPCs were cultured in a 12-well dish to confluency in NPC media and then dissociated using Accutase for 5 minutes at 37°C to single cell resolution and plated on 5 µg/mL human laminin and 5µg/mL fibronectin-coated 384 well plates (Perkin Elmer Cat #6057308) at 12,000 cells/well in NPC media and 10 µM ROCKi ...
-
bioRxiv - Immunology 2024Quote: ... Five-micrometer serial sections were stained with a human-specific anti-COXIV antibody and scanned using the Vectra® Polaris Automated Imaging System (PerkinElmer, USA) at 20×magnification ...
-
bioRxiv - Cell Biology 2019Quote: ... Acquisition was performed on at least 1000 cells per well (3 wells per condition) with 20X objective with Harmony Imaging Software 4.1 (Perkin Elmer). Image analysis was pursued using Colombus 2.5.0 software (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CB1 receptor hybridization was revealed by a TSA reaction using cyanine 3 (Cy3)-labeled tyramide (1:100 for 10 minutes, NEL744001KT PerkinElmer). After several washes ...
-
bioRxiv - Bioengineering 2019Quote: ... was performed at 24 and 72h (n=3) and cells were imaged using Operetta CLS high-content screening system (PerkinElmer) using 10x magnification and filters for calcein and EthD detection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were then incubated with Biotinyl Tyramide Amplification kits (TSA, TSA plus biotin kit, PerkinElmer), following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... using the LANCE cAMP Kit (PerkinElmer) with a high sensitivity method with 12µL per point lysate and total detection volume 24µL using 2× concentrated detection mix ...
-
bioRxiv - Neuroscience 2020Quote: Alphascreen cAMP Assay kit (6760635M, PerkinElmer) was used to measure cAMP in the samples ...