Labshake search
Citations for PerkinElmer :
101 - 150 of 1737 citations for 8 11 Methano 10a 3 6a 1 propanyl 3 ylidene 8H indeno 2 1 b azocine 12 14 dione 5 acetyloxy 4 benzoyloxy dodecahydro 1 3 dimethyl 9 methylene 3R 4S 5R 6aR 6bR 8S 10aR 11R 11aS 15S 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... before mixing with 3 ml scintillation fluid (Perkin Elmer, Waltham, MA). The radioactivity was counted for 1 min in a scintillation counter (Tri-Carb 2100TR ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supernatant was subsequently harvested and mixed with OptiPhase HiSafe 3 (PerkinElmer) scintillation fluid and incubated at RT for 16hrs ...
-
bioRxiv - Neuroscience 2019Quote: ... Signal was detected with TSA Plus cyanine 3 (PerkinElmer, Llantrisant, UK) and horseradish peroxidase ...
-
bioRxiv - Neuroscience 2019Quote: ... Plates were read on a Victor 3 Multilabel Counter (Perkin Elmer).
-
bioRxiv - Cancer Biology 2021Quote: ... and revealed using the kit TSA-Plus Cyanin-3 (Perkin Elmer).
-
bioRxiv - Neuroscience 2023Quote: ... and Cy3 (TSA Cyanine 3 Tyramide; PerkinElmer, REF#: 10197077, Lot #: 2629833) were used to visualize labeled cells ...
-
bioRxiv - Neuroscience 2022Quote: ... After adding 3 mL of emulsifier-safe scintillation cocktail (Perkin Elmer), radioactivity was quantified with a TRI-CARB 2810TR (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Genomics 2023Quote: ... in 2.8mm ceramic tubes (Cat# 19-628-3; PerkinElmer, Kennesaw, GA) and pre-chilled 700 μl QIAzol Lysis reagent ...
-
bioRxiv - Biochemistry 2023Quote: ... and the remaining lysate was mixed with Optiphase HiSafe 3 (PerkinElmer). The radioactivity was monitored using a β-scintillation counter (LSC-8000 ...
-
bioRxiv - Biophysics 2024Quote: ... filters were submerged in 3 mL OptiFluor scintillation liquid (Perkin Elmer) to allow measurement of radioactivity (DPM ...
-
bioRxiv - Cell Biology 2023Quote: All the videos (2 min, 4-5 frames s-1) were acquired at 37°C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μCi of 2-Deoxy-D-[1-2-3H] glucose (PerkinElmer, Boston, MA, USA # NET328A001MC) and 10μM non-radioactive 2-DG (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence values were measured with a Victor 3 plate reader (Perkin Elmer) and normalized to total protein content ...
-
bioRxiv - Cell Biology 2020Quote: ... The luminescence was measured on a Victor 3 plate reader (Perkin Elmer). The relative ATP levels were calculated by dividing the luminescence by the total protein concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... we used the TSA Cyanine 3 Plus Evaluation Kit (NEL744E001KT, Perkin Elmer) following the manufacturers’ instructions ...
-
bioRxiv - Immunology 2019Quote: ... Mice were injected with 3 milligrams (200 µl) of D-luciferin (PerkinElmer) substrate ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 mL methione/cysteine-free DMEM containing 100 mCi 35S (Perkin Elmer) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Color development was performed with TSA plus Cyanine 3 kit (Perkinelmer, NEL744B001KT). The following RNAscope probe was used ...
-
bioRxiv - Molecular Biology 2020Quote: A Victor 3 Multilabel Counter Model 1420 (Perkin Elmer, Waltham, MA, USA) was used for both luminescence and spectrophotometry measurements.
-
bioRxiv - Developmental Biology 2022Quote: ... and signals were detected with TSA plus Cyanine 3 system (Perkin Elmer). Those antibodies were stripped off by antigen retrieval ...
-
bioRxiv - Microbiology 2021Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre-saturated with isoflurane and oxygen mix ...
-
bioRxiv - Immunology 2021Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre-saturated with isothesia and oxygen mix ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luminescence was registered using a Victor 3 multi-well plate reader (PerkinElmer). The experiment was repeated twice.
-
bioRxiv - Microbiology 2022Quote: ... The mice were then placed into XIC-3 animal isolation chamber (PerkinElmer) pre- saturated with isothesia and oxygen mix ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were rinsed 3 times for 2 min in PBS-Tx and incubated in tyramide signal amplification (TSA) blocking reagent (PerkinElmer, FP1012) in PBS-Tx (TSA-block ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 nM [1-14C]oleate (Perkin Elmer), 50 ng/ml BODIPY 665/676 (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase activity was measured on a Victor 3 multi-label plate reader (PerkinElmer) immediately after the addition of 25μL of luciferin (Promega).
-
bioRxiv - Cell Biology 2022Quote: Images were acquired within 3 days using the Opera Phenix (40x, Perkin Elmer). Automated acquisition of 41 Z-stack per well was performed ...
-
Stem cell delivery to kidney via minimally invasive ultrasound-guided renal artery injection in micebioRxiv - Cell Biology 2019Quote: ... 3 and 7 after renal artery injection using an IVIS Lumina (PerkinElmer, USA). Mice were injected intraperitoneally with 75 mg/kg D-luciferin (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were later incubated with TSA solution (TSA plus Cyanine 3 System, PerkinElmer). DNA was stained with H33342 and images collected using a Leica DMI5500 (40x magnification) ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were developed with TSA™ Plus Cyanine 3/Fluorescein System (PerkinElmer) and mounted in ProLong™ Diamond Antifade Mountant plus DAPI (Thermo Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... Dual luciferase signal was quantified using a VICTOR-3 plate reader (Perkin Elmer). To control for transfection efficiency ...
-
bioRxiv - Immunology 2020Quote: ... Whole tumor images were scanned using the Vectra 3 Automated imaging system (PerkinElmer) and quantified using the ImagePro analysis software.
-
bioRxiv - Immunology 2020Quote: ... Luciferase activity was measured on a Victor 3 multi-label plate reader (PerkinElmer) immediately after the addition of 25μL of luciferin (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3’-end labelled with [α-32P]-cordycepin (3000 Ci/mmol, Perkin Elmer) and terminal transferase (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: ... Glycolytic flux was also measured by detritiation of [3-3H]-glucose (Perkin Elmer) as described(72) ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of each phase were collected and measured in a 2480 automatic Gamma counter Wizard 2 3” (PerkinElmer, Waltham, MA, USA). LogD value were calculated using Excel by dividing measured values of octanol by water and logarithmize the result ...
-
bioRxiv - Immunology 2019Quote: ... 14 and 21 for HIV-1 p24 antigen levels by ELISA (Perkin Elmer, Boston, MA).