Labshake search
Citations for PerkinElmer :
351 - 400 of 1026 citations for 7 AMINONAPHTHALENE 1 3 DISULFONIC ACID POTASSIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 OD600 units of early log phase cells were labeled with 80 mCi of L-[35S]-methionine/cysteine mix (Perkin Elmer). Immunoprecipitated proteins were separated on SDS-PAGE and exposed to phosphor screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Developmental Biology 2019Quote: ... were used to detect labeled probes by fluorophore deposition (Fluorescein or Cyanine 3) using the TSA Plus System (Perkin Elmer, NEL753001KT). Nuclei were stained with Hoechst 33342 (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Cell toxicity was assessed after 3 h of incubation by measuring fluorescence intensity using the Victor 3V spectrofluorometric multiwell plate reader (Perkin Elmer; excitation at 560 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...
-
bioRxiv - Neuroscience 2020Quote: ... Imaging was performed at 37°C and 3% CO2 using an Opera Phenix™ high-content confocal microscopy system (Perkin Elmer). Images were acquired at 40x magnification using a 425 nm laser for excitation of CFP and emissions detected at 435-515 nm (CFP ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were rinsed 3 times for 2 min in PBS-Tx and incubated in tyramide signal amplification (TSA) blocking reagent (PerkinElmer, FP1012) in PBS-Tx (TSA-block ...
-
bioRxiv - Microbiology 2020Quote: ... The dry filter paper was exposed to film for imaging before the individual dots on the filter paper were excised and scintillated with the addition of 3 ml scintillation fluid (Perkin Elmer). Radioactive counts were measured as scintillation counts per minute.
-
bioRxiv - Immunology 2022Quote: ... β-radioactivity was measured by liquid scintillation counting in a Beckman LS 6500 Multi-Purpose Scintillation Counter (scintillant Optiphase HiSafe 3; PerkinElmer, #1200.437). L-Alanine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... 12 pictures of at least 3 biological replicates were quantified using the Harmony high-content imaging and analysis software (Perkin Elmer).
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide probes (listed in Supplementary file 3) for the different RNAs were labelled with 0.3 mCi of [γ-32P] ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: NMuMG cells expressing either EGFP-BIK-L61G or EGFP-PUMA4E were seeded (3,000 cells per well) in multiple wells (at least 3) of a 384-well microplate (CellCarrier-384 ultra, B128 SRI/160; Perkin Elmer) and allowed to grow for 24 h before staining with the nuclear dye DRAQ5 (5nM ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 pmol of DNA oligonucleotide (Eurofins MWG Operon, Germany) were 3’-end labelled with 3.3 pmol of α-32P-dATP (Perkin Elmer) using terminal deoxynucleotidyl transferase (TdT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was washed in TTBS for 3 times and the signal was developed using Western Lightening Plus-ECL kit (PerkinElmer, Waltham, MA) and detected on HyBlot CL X-ray films (Denville).
-
bioRxiv - Molecular Biology 2021Quote: ... The plates were read at a wavelength of 460 nm using the VICTOR 3 V 1420 Multi-Label Microplate Reader (Perkin Elmer, USA). All reactions were carried out in triplicate using both antigenic peptides in separate experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Imaging involving mNG-Bud8 (Figs. 3 & S2) was performed using a spinning disk confocal microscope (Ultra-VIEW VoX CSU-X1 system; Perkin Elmer-Cetus) equipped with a 100x /1.45 NA Plan-Apochromat Lambda oil immersion objective lens (Nikon) ...
-
bioRxiv - Cell Biology 2021Quote: Time-lapse or live-cell fluorescence microscopy was performed using a Zeiss Axiovert 200 M microscope (Plan Apochromat 1006, 1.4NA objective) with an Ultra-View RS-3 spinning disk confocal system (PerkinElmer Inc., United States) which equipped with a CSU21 confocal optical scanner ...
-
bioRxiv - Neuroscience 2021Quote: Live-cell imaging was performed at 37°C and with 3% CO2 using an Opera Phenix™ high content confocal microscopy system (Perkin Elmer). One hour prior to imaging ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of each phase were collected and measured in a 2480 automatic Gamma counter Wizard 2 3” (PerkinElmer, Waltham, MA, USA). LogD value were calculated using Excel by dividing measured values of octanol by water and logarithmize the result ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2020Quote: ... HEK cell membrane proteins (100 μg/ml final concentration) were incubated with 3 nM [3H]muscimol (30 Ci/mmol; PerkinElmer Life Sciences), neurosteroid (3 nM–30 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Molecular Biology 2020Quote: 1 μl ml-1 of 0.1 mCi ml-1 14C glucose (PerkinElmer, Cat# NEC042V250UC, Waltham, MA, USA) was added to differentiation medium 48 h before the end of the experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 3H-labelled SAM (1 mCi/ml; PerkinElmer) was added to the mixture and then incubated at 30°C for 1 h with gentle shaking ...