Labshake search
Citations for PerkinElmer :
151 - 200 of 1453 citations for 6H 1 3 Dioxolo 4 5 g 1 benzopyran 6 one 7 8 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... of incubation in an isotope solution containing rubidium (86Rb+) (1 μCi/ml, 022-105721-00321-0001, POLATOM) and 3H-mannitol (4 μCi/ml, NET101, Perkin Elmer). 86Rb+ acts as a K+ congener ...
-
bioRxiv - Neuroscience 2023Quote: ... Thawed serum samples were diluted with 1xPBS 1:4 and assayed in triplicates using a fluorometer (PerkinElmer, VICTOR3V 1420 Multilabel counter) with excitation/emission of 485 nm / 535 nm (25 nm band-pass filter) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following an HRP conjugation step a TSA Opal 570 1:150 (Tyramide Signal Amplification Opal 4-Color Manual IHC Kit, Perkin Elmer) was linked to the IRF7 antibody previously bound to the slide overnight ...
-
bioRxiv - Immunology 2020Quote: ... often from an ImmPRESS® polymer detection kit followed by colour development using a tyramide signal amplification system kit with cyanine (Cy)3 or fluorescein (1:50 dilution; PerkinElmer, Waltham, MA, USA). For detection of the second antigen in dual immunofluorescence ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a Chemagic Prime 8 system (PerkinElmer). 290 μl viral sample were mixed with 10 μl extraction control sample and 300 μl lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT (1.5 × 104) cells expressing DSP1–7 (293FT/DSP1–7) were plated in 96-well plates (Perkin Elmer Life Sciences, Waltham, MA, USA) with DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Emission signal was collected using a liquid crystal tunable filter (LCTF) (VariSpec VIS-7-35, PerkinElmer, Inc. Waltham, MA, USA, 7 nm bandwidth) programmed to collect at 515 nm and a high-resolution dual-modal charge-coupled device (CCD ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... CoV-infected cells and control mock-infected cells were incubated for different periods of time with tritiated uridine ([5-3H]uridine, 1 mCi/ml, Perkin Elmer), which was mixed in a 1:1 ratio with double-concentrated medium ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of serum and supplement) with [5-3H]-glucose (Perkin Elmer) for 2-3 hours ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the samples were diluted into 5% nitric acid and 1% hydrochloric acid and tested on the PerkinElmer NexION 300D (PerkinElmer, Inc.). A calibration curve with known Au concentrations was prepared and the Au concentration was determined according to absorbance values ...
-
bioRxiv - Immunology 2020Quote: We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... in the ratio of 5:95 and analyzed at mid-IR region (400–4000 cm−1) by FTIR using Spectrum GX (PerkinElmer, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Following HRP development, TSA Plus Cyanine3 (Cy3, for Trpa1) and Cyanine 5 (Cy5, for Oprk1) fluorophores (Perkin Elmer, 1:1500 dilution) were applied for 30min at 40°C ...
-
bioRxiv - Microbiology 2023Quote: ... collected water samples (50 mL) were immediately spiked with 5 µCi of NaH14CO3 (Perkin Elmer, specific activity 56 mCi mmol−1). The samples were incubated for 24 h under in situ natural illumination ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5 mg/ml was added 1-hour prior to medium collection and fluorescence intensities were analyzed with plate reader (PerkinElmer 2030).
-
bioRxiv - Molecular Biology 2020Quote: 1 μl ml-1 of 0.1 mCi ml-1 14C glucose (PerkinElmer, Cat# NEC042V250UC, Waltham, MA, USA) was added to differentiation medium 48 h before the end of the experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... Confluent cultures were changed by quiescent medium for 24 h before they were labelled for 4 h with 1 μCi/ml [3H] arachidonic acid (PerkinElmer Life Sciences). Washing cells once with PBS containing 0.1% free fatty acid albumin and twice with PBS alone ...
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 3H-labelled SAM (1 mCi/ml; PerkinElmer) was added to the mixture and then incubated at 30°C for 1 h with gentle shaking ...
-
bioRxiv - Synthetic Biology 2023Quote: ... merged into one plane using Openlab software (PerkinElmer) and processed further in Photoshop (Adobe) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 10 min in Cy3 Plus Amplification Reagent diluted 1:300 in 1x Plus Amplification Diluent (TSA Plus Cyanine 3 System, Perkin Elmer, Waltham, MA, NEL744001KT), washed several times in TBS with 0.3% Triton X-100 and 0.05% Tween 20 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ligand-stimulated cAMP accumulation in the presence or absence of 0.5 mM 3-isobutyl-1-methylxanthine (IBMX) was measured after the indicated times of stimulation using LANCE® cAMP Detection Kit (Perkin Elmer Life Sciences) and a Mithras LB 940 multimode microplate reader ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7 mCi of γ-32P-ATP (PerkinElmer, 3000 Ci/mmol), and either DMSO or 2 μM of the Cdk4/6-inhibitor Palbociclib (Selleckchem ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... All the videos (2 min, 4 frames s-1) were acquired at 37 °C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were fixed with 2% PFA at RT for 30 min and stained with the Hoechst 33342 dye (1 μg/ml) at 37 °C and 5% CO2 before imaging with the Operetta™ high content imaging system (PerkinElmer Inc.). Forty fields were acquired from each well using appropriate filter sets ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were treated with 1 μCi 1-14C (Perkin Elmer, NEC043X050UC) or 6-14C glucose (Perkin Elmer ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were treated with 1 μM [1-14C]-oleic acid (PerkinElmer) diluted in high glucose DMEM containing 0.05% BSA for 1h ...
-
bioRxiv - Biochemistry 2021Quote: ... bound to albumin (1:1 molar ratio) or 0.1 μM [1-14C]oleic acid (2 μCi/dish Perkin Elmer) bound to albumin (1:1 molar ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... were transfected into the indicated cells (HEK293/17: 4×105/well; CHO: 2.5×104/well, BMVECs: 5×103/well) in 96-well plates (PerkinElmer, 6005680) in triplicate ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Neuroscience 2022Quote: ... siScrambled or siAbdc1/2 Astrocytes were incubated overnight with DMEM without glucose supplemented with 1% FBS containing 1 μCi/mL 14C-Acetate ([1-14C] acetate, 58 mCi/mmol, PerkinElmer) and or α-cyclo or 50 μM C26:0 ...
-
bioRxiv - Developmental Biology 2022Quote: ... L-[3H(G)]-Serine (PerkinElmer NET248250UC), L-[14C(U)]-Glycine (PerkinElmer NEC276E050UC) ...
-
bioRxiv - Biochemistry 2020Quote: ... and ATP [g-32P] (Perkin Elmer). Radiolabeled primers were individually mixed with the DNA template containing an 8-oxoG lesion at the 23rd base from the 3’ end (t528 ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Microbiology 2023Quote: Apical wash fractions collected pre- and post-infection were used to detect Lactate dehydrogenase activity and IL-8 concentrations using human LDH and IL-8 Alphalisa Kits (Perkin Elmer). ELISA Kits for the detection of human TNFα ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transcripts were labeled with the Opal 7 Kit (Perkin Elmer, NEL797001KT): Opal 520 (1:1500) ...