Labshake search
Citations for PerkinElmer :
201 - 250 of 1551 citations for 6 propan 2 yl 1 3 5 triazine 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The colorimetric reaction was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1:1000 Cyanine 5 amplification reagent (PerkinElmer, #FP117024UG) in TSA buffer (ACD ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3H-mannitol (4 µCi ml−1, NET101, Perkin Elmer), the latter serves as an extracellular marker 33 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Immunology 2021Quote: ... was added for 2 minutes before reading with a PerkinElmer Envision instrument (PerkinElmer, Waltham, MA). 50% neutralization titer (ID50 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Multiplex stained slides were imaged using the Vectra Multispectral Imaging System version 2 (Perkin Elmer). Filter cubes used for multispectral imaging were DAPI (440–680 nm) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 pmol of DNA was incubated with 2 μL 5mCi [γ32-P]ATP (Perkin Elmer) and 4 μL T4 polynucleotide kinase (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... PRKACA inhibiting activity was screened using the EZ Reader 2 electrophoretic mobility shift platform (PerkinElmer). PRKACA enzyme (0.007 ng/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The washed sepharose was then directly added to 2 mL Ultima GoldTM scintillation cocktail (PerkinElmer). Radioactivity was read by a Tri-Carb 2910TR scintillation counter (PerkinElmer) ...
-
bioRxiv - Neuroscience 2020Quote: ... Radioactivity of the filter paper was measured in a Microbeta 2 Scintillation Counter (Perkin Elmer) after addition of 3 mL Ultima-Gold Scintillation Fluid ...
-
bioRxiv - Microbiology 2023Quote: ... Infected cells were lysed 2 days after infection with a britelite plus (PerkinElmer, Cat#6066769), and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Physiology 2024Quote: ... Filters were dissolved in 2 ml liquid scintillation fluid (Filter Count, PerkinElmer, Waltham, MA, USA) and counted ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µM S-adenosyl Methionine (1 µM 3H-SAM (Perkin Elmer); 3 µM cold SAM ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity was read approximately 2 min later using a Wallac Victor3 plate reader (Perkin Elmer). 50% ADCC titers were estimated as previously described for virus neutralization assays (41) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 500 µM ATP (with 2 μCi of [γ-32P] ATP added per reaction; PerkinElmer BLU502Z250UC). Phosphorylated proteins were separated on 10% SDS-PAGE gels unless stated otherwise ...
-
bioRxiv - Physiology 2020Quote: ... Cells were incubated with 50 μM 2DG containing 0.25 μCi 3H-2-deoxyglucose (2DG, Perkin Elmer) for 5 min and washed three times with cold PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Isolated cardiac myocytes were incubated with 0.1 mM [1,3-3H]glycerol (2 μCi/dish, Perkin Elmer) or 0.1 μM [1-14C]linoleic acid (2 μCi/dish ...
-
bioRxiv - Neuroscience 2023Quote: ... Isotope content was determined in 2 ml Ultima Gold™ XR scintillation liquid (6013119, Perkin Elmer) using the Tri-Carb 2900TR Liquid Scintillation Analyzer (Packard) ...
-
bioRxiv - Cell Biology 2024Quote: ... The organs were harvested and imaged using the IVIS Lumina XRMS Series 2 instrument (PerkinElmer, USA) to assess the biodistribution of mannose ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA® Plus Cyanine 5 (1:1000, Perkin Elmer NEL745E001KT) evaluation kits ...
-
bioRxiv - Neuroscience 2019Quote: ... were transfected into the indicated cells (HEK293/17: 4×105/well; CHO: 2.5×104/well, BMVECs: 5×103/well) in 96-well plates (PerkinElmer, 6005680) in triplicate ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Immunology 2019Quote: ... 2 × 103 cells were plated in pre-coated 96 well plates (CellCarrier-96 Ultra Microplates, black, PerkinElmer) following the same procedure.
-
bioRxiv - Systems Biology 2021Quote: ... columns 2-23 were used) of tissue-culture treated black CellCarrier-384 Ultra Microplates (Perkin Elmer 6057302) using a 12-channel electronic multichannel 200 μL pipettor [Sartorius] ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were loaded with 2 μCi/ml D-[2,3-3H]aspartate (Perkin Elmer, Waltham, MA, cat. #NET50100) in MEM +HIHS cell culture medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µL of cell culture medium or standard solution was added to an Optiplate-384 microplate (PerkinElmer). 21µL of 10X mixture including acceptor beads and biotinylated antibody was then added to the wells with culture media or standard solution ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... the sections were incubated with diluted TSA plus Cy-3 (1:750, PerkinElmer, #NEL741001KT) for 30 minutes at 40°C in the oven ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Genomics 2020Quote: ... and labeled with TSA Cyanine 5 (Perkin Elmer #NEL705A001KT, 1:1000 dilution). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μM cold ATP and 5 μCi [γ32P] - ATP (Perkin Elmer, USA). The reaction was incubated for 30 minutes at 30°C and stopped by adding Laemmli buffer and boiling at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µCi of [1-14C] acetate (NEC084H001MC, Perkin Elmer, Waltham, MA, USA) per mL was added and the cells were cultured for four more hours ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were anesthetized (2 % isofluorane gas in O2) and luminescence was recorded (IVIS Spectrum, Perkin Elmer, Waltham, MA). Images were analyzed with Living Image Software (Caliper LifeSciences).