Labshake search
Citations for PerkinElmer :
151 - 200 of 1394 citations for 6 oxo 1 phenyl 1 4 5 6 tetrahydro pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Cell Biology 2022Quote: ... Hybridization signals were detected by a chromogenic reaction using red chromogen dilution 1:3000 (PerkinElmer TSA Plus Cyanine 3 System). RNA-staining signal was identified as red punctate dots and clusters ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µCi of [1-14C]-palmitate (2.22 GBq mmol-1, Perkin Elmer) was added to 10 ml culture medium of exponentially or stationary phase-grown bacteria and further incubated for 1.5 h at 30°C ...
-
bioRxiv - Neuroscience 2020Quote: ... The 5 μg of thawed S1 protein was radioactively labeled with 1 mCi 125I (Perkin Elmer, Waltman, MA) using the chloramine-T method 30 ...
-
bioRxiv - Microbiology 2021Quote: ... of which one was [5’-32P] single-end labelled with (γ 32P)-ATP (Perkin Elmer, 3000 Ci.mmol-1) and T4 polynucleotide kinase (Thermofisher ...
-
bioRxiv - Microbiology 2023Quote: The ROS production by macrophages was measured by chemiluminescence in the presence of 5-amino-2,3-dihydro-1,4-phthalazinedione (luminol) using a thermostatically (37°C) controlled for 1 hr (Envision, PerkinElmer). For nitrite release ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Neuroscience 2020Quote: ... was used as a secondary fluorophore for C1 probes (Gtpbp2, Slc7a1, Chac1) and TSA® Plus Cyanine 3 (PerkinElmer, 1:2,000) was used as a secondary fluorophore for C2 probes (Gtpbp1 ...
-
Peripheral neuropathy linked mRNA export factor GANP reshapes gene regulation in human motor neuronsbioRxiv - Neuroscience 2021Quote: ... were hybridized for 2 h at 40°C followed by signal amplification and developing the HRP channel with TSA Plus fluorophore Cyanine 3 (1:1500) (NEL744001KT, Perkin Elmer) according to the manual ...
-
bioRxiv - Cell Biology 2024Quote: ... After two washes of 5min in 1X RNAscope wash buffer slides were incubated with 1:1500 Cyanine 3 amplification reagent (PerkinElmer, #FP1170012UG), or 1:1000 Cyanine 5 amplification reagent (PerkinElmer ...
-
bioRxiv - Pathology 2023Quote: 14C-labeled palmitic acid (C16) and 14C-octanoic acid (C8) were from PerkinElmer while 14C-DC12 and 14C-lignoceric acid (C24 ...
-
bioRxiv - Cell Biology 2020Quote: ... image stacks (5 × 1 μm optical sections) were acquired on a spinning disc confocal system (Ultraview Vox, Perkin Elmer) with a 60× 1.4 NA oil-immersion objective (Nikon ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET readout was performed after 1 h incubation at 4°C using an EnVision 2105 Multimode Plate Reader (PerkinElmer) with previously defined measurement parameters53 ...
-
bioRxiv - Neuroscience 2022Quote: ... 022-105721-00321-0001, POLATOM, as a marker for K+ transport, and 4 μCi ml-1 3H-mannitol as an extracellular marker, PerkinElmer) for 2min (influx ...
-
bioRxiv - Molecular Biology 2021Quote: HDL-sRNA libraries were generated using the NEXTFlex Small RNA-Seq Kit v3 with 1:4 adapter dilution and 22 PCR cycles (PerkinElmer). Following PCR amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... was next added and incubated with the mixture at 4 °C for 1 hour before the measurements performed on Envision Readers (PerkinElmer). The fluorescently-labeled m6A-containing mRNA was used to adjust the gain factor ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were blocked with 5% BSA in Tris / HCl-buffered saline / 0.05% Tween (TBST) for 24 h at 4 °C and afterwards membranes were incubated for 1 h with HRP-Streptavidin (PerkinElmer; #NEL750001EA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-plex positive control probe or with a cocktail of Abcb5-C1 and Abcb4-C2 probes with a 1:750 dilution of TSA-Fluorescein Plus and TSA-Cyanine 3 Plus (PerkinElmer, Shelton, CT), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1:3 dilution steps) using a Janus Gripper with 384-channel Modular Dispense Technology dispensing head (revvity, previously Perkin Elmer, MA, USA). Afterwards ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... of incubation in an isotope solution containing rubidium (86Rb+) (1 μCi/ml, 022-105721-00321-0001, POLATOM) and 3H-mannitol (4 μCi/ml, NET101, Perkin Elmer). 86Rb+ acts as a K+ congener ...
-
bioRxiv - Neuroscience 2023Quote: ... Thawed serum samples were diluted with 1xPBS 1:4 and assayed in triplicates using a fluorometer (PerkinElmer, VICTOR3V 1420 Multilabel counter) with excitation/emission of 485 nm / 535 nm (25 nm band-pass filter) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following an HRP conjugation step a TSA Opal 570 1:150 (Tyramide Signal Amplification Opal 4-Color Manual IHC Kit, Perkin Elmer) was linked to the IRF7 antibody previously bound to the slide overnight ...
-
bioRxiv - Immunology 2020Quote: ... often from an ImmPRESS® polymer detection kit followed by colour development using a tyramide signal amplification system kit with cyanine (Cy)3 or fluorescein (1:50 dilution; PerkinElmer, Waltham, MA, USA). For detection of the second antigen in dual immunofluorescence ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... CoV-infected cells and control mock-infected cells were incubated for different periods of time with tritiated uridine ([5-3H]uridine, 1 mCi/ml, Perkin Elmer), which was mixed in a 1:1 ratio with double-concentrated medium ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of serum and supplement) with [5-3H]-glucose (Perkin Elmer) for 2-3 hours ...
-
bioRxiv - Immunology 2020Quote: We stained 5-µm-thick formalin-fixed paraffin-embedded sections from human xenograft tumors (UMSCC-1) using Opal multiplex kits (PerkinElmer/Akoya), for a panel of DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... in the ratio of 5:95 and analyzed at mid-IR region (400–4000 cm−1) by FTIR using Spectrum GX (PerkinElmer, USA).
-
bioRxiv - Neuroscience 2022Quote: ... Following HRP development, TSA Plus Cyanine3 (Cy3, for Trpa1) and Cyanine 5 (Cy5, for Oprk1) fluorophores (Perkin Elmer, 1:1500 dilution) were applied for 30min at 40°C ...
-
bioRxiv - Microbiology 2023Quote: ... collected water samples (50 mL) were immediately spiked with 5 µCi of NaH14CO3 (Perkin Elmer, specific activity 56 mCi mmol−1). The samples were incubated for 24 h under in situ natural illumination ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5 mg/ml was added 1-hour prior to medium collection and fluorescence intensities were analyzed with plate reader (PerkinElmer 2030).
-
bioRxiv - Molecular Biology 2020Quote: 1 μl ml-1 of 0.1 mCi ml-1 14C glucose (PerkinElmer, Cat# NEC042V250UC, Waltham, MA, USA) was added to differentiation medium 48 h before the end of the experiments ...
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 3H-labelled SAM (1 mCi/ml; PerkinElmer) was added to the mixture and then incubated at 30°C for 1 h with gentle shaking ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Physiology 2024Quote: ... [14C(U)] palmitic acid (Perkin Elmer), and [14C] triolein (TG) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated for 10 min in Cy3 Plus Amplification Reagent diluted 1:300 in 1x Plus Amplification Diluent (TSA Plus Cyanine 3 System, Perkin Elmer, Waltham, MA, NEL744001KT), washed several times in TBS with 0.3% Triton X-100 and 0.05% Tween 20 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ligand-stimulated cAMP accumulation in the presence or absence of 0.5 mM 3-isobutyl-1-methylxanthine (IBMX) was measured after the indicated times of stimulation using LANCE® cAMP Detection Kit (Perkin Elmer Life Sciences) and a Mithras LB 940 multimode microplate reader ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...