Labshake search
Citations for PerkinElmer :
201 - 250 of 1603 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... uptake inhibition and degradation were determined in M[0] and M[IL-4] using 3H-choline chloride (Perkin Elmer) as previously described [4].
-
bioRxiv - Cell Biology 2022Quote: Candidate small RNA sequences were identified from raw sequence data using cutadapt (ver. 2.8)21 with parameters “-u -4 -a A(10)” as recommended by PerkinElmer NextFlex Combo-Seq kit ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were then lysed with 1 mL of 0.1 N NaOH and mixed with 3.5 mL of Emulsifier-Safe cocktail (PerkinElmer). Radioactivity was measured using a -scintillation counter ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then changed to 600 μl medium containing 1 μCi [9,10(n)-3H]palmitic acid (Perkin Elmer) and 1 mM carnitine for 2 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Immunology 2022Quote: ... L-[3,43H(N)]-glutamine (3H-glutamine; PerkinElmer, #NET551001MC) uptake was carried out using 1 million cells resuspended in 0.4 mL HBSS (Thermo ...
-
bioRxiv - Biochemistry 2023Quote: ... [9,10-3H(N)]-triolein was obtained from PerkinElmer Life Sciences (Waltham ...
-
bioRxiv - Biophysics 2021Quote: ... Cell fixation was performed 24h after transfection using 4% formaldehyde and cellular imaging was performed using an Operetta CLS (PerkinElmer). Three individual plate preparations were used as independent experiments for statistical significance (n=3) ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 4 h at 37°C and fluorescent signal intensity was quantified using the EnSpire Multimode Plate Reader (PerkinElmer) at excitation and emission wavelengths of 540 and 612 nm respectively.
-
bioRxiv - Molecular Biology 2020Quote: ... The protein pellet was then re-suspended in PBS and incubated in 4 mL of scintillation fluid (Insta-Gel Plus, PerkinElmer) for 24 h (to homogenize the samples ...
-
bioRxiv - Biophysics 2020Quote: ... separated free and bound radioligand and the radioactivity on each filter determined by the addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and count using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... To quantify α1-3;5GABAAR79 sections were incubated for 60 minutes at 4°C in 1nM [3H]flumazenil (Perkin Elmer, NET757001MC), or in 1nM [3H]flumazenil with 10 µM flunitrazepam (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA samples were separated on a 7 M urea denaturing polyacrylamide gel at 4°C at 100V and transferred onto a charged nylon transfer membrane (PerkinElmer), followed by cross-linking using a UV Stratalinker and drying at 80°C on a Gel Dryer (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Aerrane (Isoflurane, Baxter) inhalation was performed for anesthesia using the RAS-4 Rodent Anesthesia System (Perkin Elmer, Waltham, MA, USA) for experiments with IVIS Spectrum CT living imaging system (Perkin Elmer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed with PBS and then stored in PBS at 4°C until imaged in the Opera Phenix (PerkinElmer) at 40x magnification and images analysed using a Harmony software to assess protein expression and morphology (see supplementary).
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Bioengineering 2024Quote: ... The plates were incubated for 4 h at 37°C and then the supernatant was removed and incubated with scintillation fluid (PerkinElmer) overnight at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then separated on a HayeSep column (7’ HayeSep N 1/8’’ Sf; PerkinElmer Inc., Waltham, USA), followed by molecular sieve (9’ Molecular Sieve 13x 1/8’’ Sf ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA® Plus Cyanine 5 (1:1000, Perkin Elmer NEL745E001KT) evaluation kits ...
-
bioRxiv - Cell Biology 2021Quote: ... p-ERK 1/2 (Thr202/Tyr204) (PerkinElmer, #ALSU-PERK-A500), p-GSK-3β (Ser9 ...
-
bioRxiv - Immunology 2020Quote: ... Plates were stored in the dark at 4°C prior to imaging using a 40x objective mounted on an Operetta High-Content Imaging System (Perkin Elmer) controlled by Harmony 4.1 software.
-
bioRxiv - Cell Biology 2021Quote: ... diluted in buffer A to a final concentration of 4 nM) was added to a 384-well microplate (OptiPlateTM-384 Plus, Perkin Elmer) followed by the addition of 15 μL diluted proteins and 5 μL of the GFP antibody-conjugated acceptor beads (5x) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were prehybridized and hybridized at 45°C for 4 hours in 50% (Vol/Vol) formamide hybridization buffer containing 35S-labeled antisense RNA probes (Perkin Elmer). RNase A-resistant hybrids were detected by autoradiography ...
-
bioRxiv - Plant Biology 2022Quote: ... 5-mm root segments away from the apical 2 mm root tip and 2 mm away from the root-shoot junction were carefully cut and soaked overnight in 4 ml of liquid scintillation fluid (Ultima Gold, PerkinElmer, USA), and the radioactivity was measured with a scintillation counter (model LS6500 ...
-
bioRxiv - Physiology 2020Quote: ... Each filter was then placed in a Sterilin™ scintillation vial and radioactivity determined by: addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and the retained radioactivity determined using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
Surveying the landscape of tRNA modifications by combining tRNA sequencing and RNA mass spectrometrybioRxiv - Biochemistry 2019Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42 °C with 4 pmol DNA probes radiolabeled with [γ-32P]ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42°C with 4 pmol probes (Table S3) that were radiolabeled using [γ-32P] ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were cut as 4 μm sections and automated IF was performed on a Leica Bond Rx Platform at room temperature using the PerkinElmer Opal 4-Colour Automation IHC Kit (PerkinElmer, #NEL800001KT). Tissue sections were blocked with 3% Hydrogen peroxide (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... media was changed to low-glucose DMEM supplemented with an additional 25 μM unlabelled phenylalanine and 4 μL of [14C]phenylalanine (NEC284E050UC; Perkin Elmer) per mL for 6 h ...
-
bioRxiv - Microbiology 2021Quote: ... L-[3,4,5-3H(N)] (cat. NET460A005MC, PerkinElmer, MA, USA). To reduce the potential for autodegradation of the leucine radiolabel ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... the sections were incubated with diluted TSA plus Cy-3 (1:750, PerkinElmer, #NEL741001KT) for 30 minutes at 40°C in the oven ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were then processed for visualization using the RNA-scope Multiplex Fluorescent reagent Kit v2 (Advanced Cell Diagnostics) and the Tyramide Signal Amplification (TSA™) Plus Cyanine 3 and TSA Plus Cyanine 5 systems (Perkin Elmer).
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Genomics 2023Quote: ... at a total concentration equivalent to 0.8 μM nucleosomes and 5.0 μM 14C-SAM (S- [methyl-14C]-adenosyl-l-methionine (PerkinElmer, no. NEC363050UC)) ...
-
bioRxiv - Microbiology 2024Quote: ... Of each sample three replicates and two formaldehyde-fixed (final conc. 1.85 %) adsorption blanks were spiked with [methyl-3H]-thymidine and L-[14C(U)]-leucine (Perkin Elmer) at saturating concentrations of 20 nM and 150 nM ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were rinsed 3 times for 2 min in PBS-Tx and incubated in tyramide signal amplification (TSA) blocking reagent (PerkinElmer, FP1012) in PBS-Tx (TSA-block ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...