Labshake search
Citations for PerkinElmer :
101 - 150 of 914 citations for 6 Methyl 4 5 6 7 tetrahydrobenzo b thiophene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... dissolved in 0.1% nitric acid and 4 mL Optima Gold XR scintillant (Perkin Elmer, Glen Waverley, VIC, Australia) was added prior to counting for two minutes using a Liquid Scintillation Counter (LS6500 ...
-
bioRxiv - Microbiology 2021Quote: ... The filters were immersed into 4 ml liquid scintillation cocktail (Optiphase HiSafe 3, Perkin Elmer) and the radioactivity of each filter was measured by a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2021Quote: ... Thirty μL of tissue homogenate supernatant were mixed with 370 μL of the oxidation reaction mixture containing 7% BSA/5 mM palmitate/0.01 μCi/μL 14C-palmitate (PerkinElmer, Waltham, MA) and incubated at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% BSA and 3 µl [35S] EasyTag Express protein labelling mix (7 mCi, 259 MBq, 1175 Ci/mmol in 632 ml; Perkin Elmer, Espoo, Finland). After 2 h of incubation at 37 °C cells were washed twice with PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl of the virus or virus-antibody complex was added to each well in triplicates and allowed to incubate for 6 hrs before the cells were lysed with 50 µl/well of steadylite plus luciferase reagent (Perkin Elmer; 6066751). The luciferase activity was quantified using a BMG PHERAstar FS plate reader.
-
bioRxiv - Genetics 2020Quote: ... 50 U of DNA polymerase I (M0209S) and 30 μM of each dNTP including 6 μM of Fluorescein-12-dATP (Perkin Elmer, NEL465001EA) or 6 μM of Texas Red-5-dATP (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2021Quote: ... Radioactivity was measured by adding the samples into 4 ml liquid scintillation cocktail (OptiphaseHiSafe 3, PerkinElmer) and counting with a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Opal 7 manual kit (PerkinElmer) was used according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2021Quote: NPCs were seeded onto poly-L-ornithine/laminin-coated 6-well and cyclic olefin co-polymer-based 96-well Cell Carrier Ultra microtiter plates (Perkin Elmer, Waltham, MA) at 1×105 and 2×103 cells/well ...
-
bioRxiv - Biochemistry 2023Quote: The expression of IL-6 and TNF-α in culture supernatants was detected using the corresponding AlphaLISA Immunoassay Kit (PerkinElmer, AL223C and AL208C) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.9µM (0.5 µCi) S-[Methyl-3H]-Adenosyl-L-methionine (17.2 mCi/mL, Perkin Elmer)) and incubated at 30 °C ...
-
bioRxiv - Immunology 2021Quote: ... after incubation for 16 h with 1 µCi/ml [methyl-3H]-thymidine (Perkin Elmer). Data were expressed as counts per min (Cpm ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μM S-adenosyl-L-[methyl-3H]methionine (specific activity 18 Ci/mmol, PerkinElmer) in 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.093% of the total choline was radioactive ([Methyl-3H]-Choline Chloride; Perkin Elmer #NET109001MC)(Choline Chloride ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.55 μM S-adenosyl-L-[methyl-3H] methionine (specific activity 58.9 Ci/mmol, PerkinElmer) in 50 mM Tris–HCl (pH 7.2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
bioRxiv - Cell Biology 2021Quote: ... Then it was mixed with reaction B which contain 5 μg of the GST-substrate in 5x Kinase buffer containing 2 μCi γ-32P-ATP (PerkinElmer, BLU002Z250UC) in 10-μl reactions ...
-
bioRxiv - Cell Biology 2022Quote: ... Bioluminescence imaging was performed at days 5 and 7 post engraftment using an IVIS Lumina III in vivo imaging system (Perkin Elmer, Waltham, MA). IVIS instrument exposure time was 3 seconds ...
-
bioRxiv - Molecular Biology 2021Quote: ... with or without EcoRI hairpin oligo or NAD+ in histone methyltransferase buffer and 6 µM of radiolabeled [3H] AdoMet (Perkin Elmer Life Science # NET155V001MC). Recombinant human histone H4 (New England Biolabs # M2504S ...
-
bioRxiv - Systems Biology 2020Quote: ... Cy5-TSA (7 min; Perkin Elmer NEL745E001KT).
-
bioRxiv - Genetics 2019Quote: ... were mounted on infrared windows where spectral images were collected at a 4 cm-1 spectral resolution and ~7 μm spatial resolution from a Spotlight 400 Imaging system (Perkin Elmer Instruments, Shelton, CT USA). Background spectra were collected under identical conditions from clear Ba2F windows and subtracted from sample data by instrumental software ...
-
bioRxiv - Neuroscience 2019Quote: ... Confluent cultures were changed by quiescent medium for 24 h before they were labelled for 4 h with 1 μCi/ml [3H] arachidonic acid (PerkinElmer Life Sciences). Washing cells once with PBS containing 0.1% free fatty acid albumin and twice with PBS alone ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Pathology 2023Quote: 14C-labeled palmitic acid (C16) and 14C-octanoic acid (C8) were from PerkinElmer while 14C-DC12 and 14C-lignoceric acid (C24 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 7 μCi [35S]-Methionine/cysteine (PerkinElmer; NEG072007MC) and labelled for 2 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.56 µM S-adenosyl-L-[methyl-3H]methionine with a specific activity of 18 Ci/mmol (PerkinElmer), 1.96 µM nonradioactive SAM ...
-
bioRxiv - Genetics 2020Quote: ... DNA methylation was measured by the incorporation of tritiated methyl groups from radioactively labeled SAM (Perkin Elmer) into the biotinylated substrate using an avidin–biotin methylation plate assay47 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Biophysics 2023Quote: ... The uptake reaction was terminated by filtering the samples through a 96 well glass fiber filter (Filtermat B – GF/B, Perkin Elmer) soaked in 1.5% poly(ethyleneimine ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT (1.5 × 104) cells expressing DSP1–7 (293FT/DSP1–7) were plated in 96-well plates (Perkin Elmer Life Sciences, Waltham, MA, USA) with DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Emission signal was collected using a liquid crystal tunable filter (LCTF) (VariSpec VIS-7-35, PerkinElmer, Inc. Waltham, MA, USA, 7 nm bandwidth) programmed to collect at 515 nm and a high-resolution dual-modal charge-coupled device (CCD ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Physiology 2024Quote: ... [14C(U)] palmitic acid (Perkin Elmer), and [14C] triolein (TG) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7 mCi of γ-32P-ATP (PerkinElmer, 3000 Ci/mmol), and either DMSO or 2 μM of the Cdk4/6-inhibitor Palbociclib (Selleckchem ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...