Labshake search
Citations for PerkinElmer :
551 - 600 of 1305 citations for 6 Chloro 4 hydroxy 3 methoxycarbonyl 2H thieno 2 3 e 1 2 thiazine 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Biophysics 2021Quote: ... Chemical structure of E- 4031 was drawn using ChemDraw (PerkinElmer) and converted to a 3D structure using OpenBabel (O’Boyle et al. ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Physiology 2020Quote: ... 0.35 ml of transport solution with 0.5 µCi/ml [3H]2-deoxy-glucose (PerkinElmer) was added to the cells for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli tRNA nucleotidyltransferase and [α-32P] ATP (final activity 2 µCi/µL) (PerkinElmer, # BLU003X250UC) in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Physiology 2023Quote: ... a bolus injection of 2-[1,2-3H(N)]deoxy-D-glucose (PerkinElmer, Boston, Massachusetts) (0.4 μCi/g body weight ...
-
bioRxiv - Cell Biology 2023Quote: ... The colorimetric reaction was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Immunology 2021Quote: ... 1 µCi of S-adenosyl [methyl-3H] methionine (0.5 μCi/μl; PerkinElmer) in reaction buffer (500 mM Tris–HCl (pH 7.5) ...
-
bioRxiv - Genomics 2020Quote: ... and labeled with TSA Cyanine 5 (Perkin Elmer #NEL705A001KT, 1:1000 dilution). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1; Perkin Elmer, Baesweiler, Germany), and Applied Biosystem’s MagMAX™ FFPE DNA Isolation Kit (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μM cold ATP and 5 μCi [γ32P] - ATP (Perkin Elmer, USA). The reaction was incubated for 30 minutes at 30°C and stopped by adding Laemmli buffer and boiling at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... Mating mixtures were digested in 1/200 Glusulase (PerkinElmer, Waltham, Massachusetts, USA) at room temperature overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µCi of [1-14C] acetate (NEC084H001MC, Perkin Elmer, Waltham, MA, USA) per mL was added and the cells were cultured for four more hours ...
-
bioRxiv - Molecular Biology 2020Quote: A 1 μL aliquot of 3.3 nM 32P-α-UTP (Perkin Elmer) was added to the 20-μL reaction mixture of in vitro transcription containing 4 mM ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... the gel was then incubated for 1 h in EN3HANCE (Perkin Elmer) according to manufacturer’s instructions and the reaction was visualized by fluorography.
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then incubated with Opal™ 570 reagent (1:1000; PerkinElmer) for 10 min at RT ...
-
bioRxiv - Immunology 2021Quote: ... Viral titers were quantified by HIV-1 p24 AlphaLISA assay (PerkinElmer; AL291F) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... section were incubated with TSA Cy3 (1:300, 10 min, Perkin Elmer). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... transiently transfected INS-1 cells were incubated with 3H-thymidine (Perkin Elmer) at a final concentration of 1 Ci/ml in supplemented RPMI for 4 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:200 dilution of anti-mouse IgG donor bead (Perkin Elmer, AS104D) and a 1:200 dilution of anti-rabbit IgG acceptor bead (Perkin Elmer ...
-
bioRxiv - Developmental Biology 2022Quote: ... and AMP3 and label probes Opal 570 (1:1500, PerkinElmer, Cat. FP1488001KT), Opal 650 (1:1500 ...
-
bioRxiv - Plant Biology 2023Quote: ... the leaves were sprayed with 1 mM D-luciferin (PerkinElmer, Rodgau, Germany) solution containing 0.01 % Tween-20 (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% XenoLight D-Luciferin Monopotassium Salt Bioluminiscence Substrate 100mM (PerkinElmer CN: 122799). Plates were sealed with plastic film and placed inside LumiCycle96 (ActiMetrics ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.33 mM 32P-dATP (3000 Ci/mmol, 1 Ci = 37GBq, PerkinElmer). Following a 1 h incubation at 30°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 OD600 units of early log phase cells were labeled with 80 mCi of L-[35S]-methionine/cysteine mix (Perkin Elmer). Immunoprecipitated proteins were separated on SDS-PAGE and exposed to phosphor screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Developmental Biology 2019Quote: ... were used to detect labeled probes by fluorophore deposition (Fluorescein or Cyanine 3) using the TSA Plus System (Perkin Elmer, NEL753001KT). Nuclei were stained with Hoechst 33342 (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Cell toxicity was assessed after 3 h of incubation by measuring fluorescence intensity using the Victor 3V spectrofluorometric multiwell plate reader (Perkin Elmer; excitation at 560 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...