Labshake search
Citations for PerkinElmer :
1 - 50 of 995 citations for 6 Boc 1 oxa 6 azaspiro 3.3 heptan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
bioRxiv - Cell Biology 2019Quote: GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Cancer Biology 2023Quote: ... Imaging was performed using the Vectra 3 multispectral slide scanner in conjunction with Vectra 3.3 and Phenochart 1.0.4 software (PerkinElmer). Images were unmixed in inForm 2.2.0 and a selection of 15 representative original multi-spectral images was used to train the single-cell separation algorithm in HALO™ Image Analysis software (Indica Labs ...
-
bioRxiv - Molecular Biology 2020Quote: A 1 μL aliquot of 3.3 nM 32P-α-UTP (Perkin Elmer) was added to the 20-μL reaction mixture of in vitro transcription containing 4 mM ATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 6-14C glucose (Perkin Elmer, NEC045X050UC) and incubated at 37°C for 4 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Images were acquired at 1 frame/6-10 s and analyzed using Volocity (PerkinElmer) and NIH ImageJ ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-[3H]-DA (Perkin Elmer Life Sciences, USA) as previously described (Jensen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-[3H]-DA (Perkin Elmer Life Sciences, USA) was used to obtain saturation DA uptake curves ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 pmol of DNA oligonucleotide (Eurofins MWG Operon, Germany) were 3’-end labelled with 3.3 pmol of α-32P-dATP (Perkin Elmer) using terminal deoxynucleotidyl transferase (TdT ...
-
bioRxiv - Microbiology 2021Quote: ... and Volocity 6 software (PerkinElmer Life Sciences, Boston, USA) was used to process images.
-
bioRxiv - Cell Biology 2023Quote: ... containing 6 ml Ultima Gold scintillation cocktail (Perkin Elmer). Radiation in each sample was measured as counts/minute (CPM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... supernatants were collected and IL-6 assayed with AlphaLISA (PerkinElmer) using the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... stained with spectral 4′,6-diamidino-2-phenylindole (Perkin Elmer), and coverslipped with ProLong Diamond mounting media (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ChIP-sequencing libraries were prepared using NEXTflex-6 DNA Barcodes (PerkinElmer) in DNA LoBind tubes (Eppendorf ...
-
bioRxiv - Cancer Biology 2021Quote: ... Image acquisition was performed using Volocity versions 5 and 6 (PerkinElmer). Routine imaging performed using Plan Apochromat 60 or 100× oil immersion objectives ...
-
bioRxiv - Genetics 2020Quote: ... or 6 μM of Texas Red-5-dATP (Perkin Elmer, NEL471001EA) in 800 μl of 1 × NEBuffer 2 and carried out at 37°C for 2 h ...
-
bioRxiv - Biochemistry 2021Quote: ... and 6 µl of 3000 Ci/mmol [α-32P]dATP (Perkin Elmer). The reaction mixture was initially boiled for 10 min at 95°C and subjected to 35 thermal cycles (95°C for 30 s ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 and 20 hours using IVIS Lumina Series III (PerkinElmer, Waltham, MA) at 470 nm.
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Microbiology 2022Quote: ... maintained at 200 °C and with N2 as the gas vector (flow rate of 6 mL·min-1) with a flame ionization detector (FID) maintained at 280 °C (PerkinElmer, USA)
-
bioRxiv - Cancer Biology 2024Quote: ... Eµ-Myc lymphoma cells grown in 6-well plates were spiked with 0.2 μCi/mL [1-14C]-acetate (PerkinElmer; NEC084H001MC) for the final 4 h of the experimental period ...
-
bioRxiv - Cancer Biology 2021Quote: ... Visualization and image analysis were performed using Volocity 6 Image Analysis software (PerkinElmer).
-
bioRxiv - Cell Biology 2021Quote: ... Supplemental Figure 5 and Supplemental Figure 6 were exported from Volocity (Perkin Elmer) as single files with merged Z-planes and separate channels ...
-
bioRxiv - Immunology 2021Quote: ... brain and testis tissue samples from hACE2 transgenic mice challenged intranasally with SARS-CoV-2-nLuc (1 x 105 FFU; 6 dpi) were imaged after necropsy using bioluminescence imaging (IVIS, Perkin Elmer), pruned to isolate regions with high nLuc activity and immediately pre-fixed with 3 % glutaraldehyde ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of serum and supplement) with [6-14C]-glucose (Perkin Elmer) for 6 hours ...
-
bioRxiv - Neuroscience 2020Quote: Morphological measurements of lumen volume (Figure 6) were performed using Volocity 6.3.1 (Perkin Elmer) where an object is defined by use of the built-in “findobjects” method and selecting an intensity value to set the threshold for volumetric regions based on the channel used ...
-
bioRxiv - Cell Biology 2021Quote: AlphaLISA™ Immunoassay was used to assess the IL-6 cytokine release (PerkinElmer, #AL223) in the media in 2D and 3D fibroblast cell cultures ...
-
bioRxiv - Cancer Biology 2022Quote: ... Image analysis was performed using Volocity 6 or 6.3 image processing software (Perkin Elmer).
-
bioRxiv - Cell Biology 2019Quote: ... 6 μM mRNA and 0.3 μM [35S]-fMet-tRNAfMet ([35S]-methionine from Perkin Elmer). An aliquot (4.5 μl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... In order to quantify IL-6 and TNF-α LANCE® Ultra Detection Kits (PerkinElmer, Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Imaging was performed on an Ultraview Vox spinning disk confocal system running Volocity 6 (PerkinElmer) using a standard inverted microscope (IX81 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were cultured for 6 days and cell proliferation was measured using ATPlite Luminescence Assay (PerkinElmer).
-
Transcription factor LSF facilitiates lysine methylation of α-tubulin by microtubule-associated SET8bioRxiv - Biochemistry 2019Quote: ... or recombinant MBP-β-tubulin were incubated with 6 μM radioactively labeled [3H] AdoMet (Perkin Elmer #NET155V001MC) in 1X HMT buffer containing 5 mM Tris pH 8.0 ...
-
bioRxiv - Pathology 2021Quote: ... 6 min prior to imaging using an in-vivo imaging system (IVIS; Perkin Elmer, Waltham, MA, USA) as mentioned in our work (46).
-
bioRxiv - Cancer Biology 2021Quote: ... Number of basal and suprabasal cells in each clone was counted using Volocity 6 Image Analysis software (PerkinElmer).
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Cell Biology 2022Quote: ... Hepatocytes were seeded into 6-well (300,000 per well) and 384-well microplates (1,000 per well, CulturPlate, PerkinElmer) precoated with collagen (rat tail ...
-
bioRxiv - Cell Biology 2019Quote: ... with a 60X 1.42 NA oil-immersion objective coupled to an Ultraview Vox spinning disk confocal system running Volocity 6 (PerkinElmer). Images were captured with a EMCCD camera (C9100-13 ...
-
bioRxiv - Bioengineering 2019Quote: ... and 6 post-infection was performed via radiographs with fluorescent overlays using the IVIS Lumina XRMS II system (PerkinElmer).
-
bioRxiv - Biochemistry 2019Quote: ... Plates were then washed 6 times with PBST and buffer containing PBS and 0.2 µg/ml Eu3+-streptavidin (PerkinElmer) and incubated at room temperature for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... the two replicates of the 6 h treatment time point for the H1299 cell line were acquired on an equivalent Opera Phenix imaging system (PerkinElmer). Quantitative analysis of the data was carried out using the metrics and analysis methods detailed below ...
-
bioRxiv - Molecular Biology 2019Quote: ... For micro-CT irradiation cells in 6 cm culture dishes or in 1.5 ml microcentrifuge tubes were scanned (Quantum FX, Perkin Elmer) in the low resolution mode (73 mm f.o.v. ...
-
bioRxiv - Biochemistry 2021Quote: ... and 640 μM) were added along with 10 μM of non-radiolabeled UTP plus 6 mCi of [α32P]-UTP (PerkinElmer). Upon addition of nucleotides ...
-
bioRxiv - Immunology 2020Quote: ... during the final 6 hours (murine MLR) or 15 hours (human MLR) of culture was measured by a TopCount (PerkinElmer).
-
bioRxiv - Microbiology 2022Quote: ... OD600 and luminescence measurements were taken either 1-hour post-resuspension or over 6 hours starting at 0.5-hour post-resuspension using the Victor X3 2030 multilabel plate reader (Perkin Elmer). Luminescence was measured in counts per second (CPS ...