Labshake search
Citations for PerkinElmer :
1 - 50 of 879 citations for 5 acetyl 2 methylfuran 3 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Tritiated acetyl-CoA was purchased from PerkinElmer. For each assay ...
-
bioRxiv - Biochemistry 2022Quote: ... 300 mM potassium acetate and 1 mM DTT followed by addition of 10 μM acetyl-CoA in a 1:10 ratio of 3H radiolabeled acetyl-CoA (PerkinElmer) to cold acetyl-CoA ...
-
bioRxiv - Plant Biology 2020Quote: ... and 22 nCi Acetyl-CoA (Perkin Elmer, USA). The reaction was incubated for 1 hour at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 nM of hNatD was mixed with 2 μM of radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences), 20 μM of the peptide ...
-
bioRxiv - Biophysics 2024Quote: ... 0.1 mM [1-14C] acetyl-CoA (PerkinElmer, 60 mCi/mmol), 5 µM sc-h45 RNA ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10mM sodium butyrate and 0.125 μCi of [3H]-labeled Acetyl-CoA (Perkin Elmer). Samples were then spotted on phosphocellulose paper (St Vincent’s Institute ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM ATP and 5 μCi [γ-32P] ATP (PerkinElmer) were used to start the reaction for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10mM sodium butyrate and 0.25 µCi/µl (4.9 Ci/mmol) of [3H]-labeled Acetyl-CoA (Perkin Elmer) or 0.15mM unlabeled Acetyl-CoA (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro acetylation reactions were performed using 0.1 μCi [14C] acetyl coenzyme A (Perkin Elmer Life Sciences). The unmodified and acetylated forms of RPA were separated on a 4-15% SDS PAGE gel ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Molecular Biology 2022Quote: ... 10 μL immunoprecipitated enzyme were mixed with 300 μM synthetic peptide and 50 μM [14C]-acetyl-CoA (PerkinElmer) in acetylation buffer (50 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μg of peptides and 1 μg of GCN5-ADA2 complex were incubated in 25 μl HAT buffer containing 0.625 μCi 3H-Acetyl-CoA (PerkinElmer) at 23 °C for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... 100 nM hNatB was mixed with a saturating concentration of “MDVF” peptide substrate (500 μM) and varying concentrations (1.95 μM to 1 mM) of acetyl-CoA (14C-labeled, 4 mCi mmol−1; PerkinElmer Life Sciences) for 10-minute reactions ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Plant Biology 2023Quote: ... resuspended in 2 N NaOH and mixed with 5 volumes scintillation fluid (Ultima Gold™ XR, PerkinElmer) for 14C-CPM counting in a TRI-CARB liquid scintillation counter (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Neuroscience 2020Quote: HUVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Neuroscience 2024Quote: ... The various agents used were injected in a volume of 5 µl using an internal cannula (Invivo1, part #C313IS-5/SPC, Internal Canula, 28 gauge) connected to plastic tubing (Perkin Elmer, Cat#N0695476, 2-stop, I.D. 0.19 mm) and a 10 µl glass syringe (Hamilton ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...