Labshake search
Citations for PerkinElmer :
1 - 50 of 1197 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... and developed with CDP-STAR with Nitro-Block II Enhancer system (Perkin Elmer, Rodgau, Germany).
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated 1h in blocking buffer and then incubated overnight with an anti-DNP-POD antibody (1:1000, Perkin Elmer). The next day embryos were washed in PBS-Tween ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Cancer Biology 2020Quote: ... in PBS for 1h at RT and with TNB blocking buffer (PerkinElmer) for 30 min for EF5 staining ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were imaged for 2h on an Opera Phoenix high throughput imaging system (Perkin Elmer) using a 20x objective over 5 consistent fields of view per well ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 nM [1-14C]oleate (Perkin Elmer), 50 ng/ml BODIPY 665/676 (Life Technologies) ...
-
bioRxiv - Pathology 2021Quote: ... primary hepatocytes were serum-starved for 3 hours and incubated for 3-hour with [1-14C] acetate (1 μCi/ml; Perkin Elmer, Boston, MA) and 5.5 mM of non-labeled (cold ...
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 3 (1:1000, Perkin Elmer NEL744E001KT), and TSA® Plus Cyanine 5 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA Plus Cyanine 3 System (Perkin Elmer, 1:50). Nuclear staining was obtained using DAPI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 5 (PerkinElmer, 1:1,000) was used as a secondary fluorophore for C1 probes (Gtpbp2 ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... for 1h at RT with following blocking with TSA blocking reagent (Perkin Elmer, Waltham, MA, USA, FP1020) as 0.5% solution in PBS pH 7.4 for another 1h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Plant Biology 2020Quote: ... For all assays 1 μCi [3 H]-D-glucose (PerkinElmer, USA) was used as the radioactive tracer ...
-
bioRxiv - Genetics 2022Quote: ... treated with the TSA Plus Cyanine 3 System 1% (PerkinElmer, USA) for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1: 5000 followed by incubation with 1:50 to 1: 100 TSA plus Cyanine 3 solution (Perkin Elmer). To detect two genes at a time ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1:1000 Cyanine 5 amplification reagent (PerkinElmer, #FP117024UG) in TSA buffer (ACD ...
-
bioRxiv - Immunology 2021Quote: ... The gels were de-stained and scanned using a ProXPRESS Proteomic Imaging System (PerkinElmer, Ma, USA).
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated for 1h in methionine (Met)- and cysteine (Cys)-free DMEM supplemented with 250μCi of 35S-Met/Cys radiolabel (PerkinElmer) per condition at normoxia ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Hoechst (1µg/ml) for 1h at room temperature before washing with PBS and analysing on the Operetta CLS (PerkinElmer). Cells were imaged at 10X using the following channels ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Plates were incubated at room temperature for 2h before measurement of the fluorescence using an EnVision Multimode Plate (Reader PerkinElmer Life and Analytical Sciences). All values were converted to cAMP concentration using cAMP standard curve performed parallel and data were subsequently normalized to the response of 100μM forskolin in each cell line ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA® Plus Cyanine 5 (1:1000, Perkin Elmer NEL745E001KT) evaluation kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were sacrificed 1h post-injection to quantify the fluorescence intensity of the organs ex-vivo with IVIS Lumina III (Perkin Elmer).Average of fluorescent photons per lung were quantify as radiant ef-ficiency [photon/second/cm2/sr] / [µW/cm2] ...
-
bioRxiv - Biochemistry 2021Quote: ... Complexes were incubated for 1h at 37°C and luminescence released by the [14C]-RITA-excited beads was measured in standard microplate reader (Perkin Elmer).
-
bioRxiv - Microbiology 2021Quote: ... The plate was then incubated for 1h at RT in the dark before the AlphaLISA signal was detected using an EnSpire Multimode Plate Reader (Perkin Elmer). Negative control with binding buffer was used to control the assay quality ...