Labshake search
Citations for PerkinElmer :
1 - 50 of 1427 citations for 5 Methoxy 1 Triisopropylsilyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... Then it was mixed with reaction B which contain 5 μg of the GST-substrate in 5x Kinase buffer containing 2 μCi γ-32P-ATP (PerkinElmer, BLU002Z250UC) in 10-μl reactions ...
-
bioRxiv - Physiology 2020Quote: ... TSA® Plus fluorophore for channel 2 (cyanine 3, PerkinElmer; 1:1000; 30 min), HRP blocker (15 min) ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated 1h in blocking buffer and then incubated overnight with an anti-DNP-POD antibody (1:1000, Perkin Elmer). The next day embryos were washed in PBS-Tween ...
-
bioRxiv - Biochemistry 2022Quote: ... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alphascreen Surefire Akt1/2/3 (p-Ser473) Phosphorylation kit (PerkinElmer, TGRA4S), Collagenase Type II (Scimar Australia ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Cancer Biology 2020Quote: ... in PBS for 1h at RT and with TNB blocking buffer (PerkinElmer) for 30 min for EF5 staining ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM ATP and 5 μCi [γ-32P] ATP (PerkinElmer) were used to start the reaction for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cell Biology 2024Quote: ... and membranes were incubated 1 min with in a 1:1 mixture of ECL solutions A and B (PerkinElmer, USA). Excess ECL solution was removed ...
-
bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μCi of 2-Deoxy-D-[1-2-3H] glucose (PerkinElmer, Boston, MA, USA # NET328A001MC) and 10μM non-radioactive 2-DG (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 nM [1-14C]oleate (Perkin Elmer), 50 ng/ml BODIPY 665/676 (Life Technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Pathology 2021Quote: ... primary hepatocytes were serum-starved for 3 hours and incubated for 3-hour with [1-14C] acetate (1 μCi/ml; Perkin Elmer, Boston, MA) and 5.5 mM of non-labeled (cold ...
-
bioRxiv - Cell Biology 2023Quote: All the videos (2 min, 4-5 frames s-1) were acquired at 37°C using a Nikon TIRF microscopy system (Perkin Elmer, Waltham, MA) on an inverted Ti microscope equipped with a 100× objective and an ImageEM C9100-13 camera (Hamamatsu Photonics ...
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 3 (1:1000, Perkin Elmer NEL744E001KT), and TSA® Plus Cyanine 5 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA Plus Cyanine 3 System (Perkin Elmer, 1:50). Nuclear staining was obtained using DAPI (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... TSA® Plus Cyanine 5 (PerkinElmer, 1:1,000) was used as a secondary fluorophore for C1 probes (Gtpbp2 ...
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... for 1h at RT with following blocking with TSA blocking reagent (Perkin Elmer, Waltham, MA, USA, FP1020) as 0.5% solution in PBS pH 7.4 for another 1h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Plant Biology 2020Quote: ... For all assays 1 μCi [3 H]-D-glucose (PerkinElmer, USA) was used as the radioactive tracer ...
-
bioRxiv - Genetics 2022Quote: ... treated with the TSA Plus Cyanine 3 System 1% (PerkinElmer, USA) for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1: 5000 followed by incubation with 1:50 to 1: 100 TSA plus Cyanine 3 solution (Perkin Elmer). To detect two genes at a time ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Cell Biology 2024Quote: ... or 1:1000 Cyanine 5 amplification reagent (PerkinElmer, #FP117024UG) in TSA buffer (ACD ...
-
bioRxiv - Cell Biology 2021Quote: ... ERK 1/2 Total (PerkinElmer, #ALSU-TERK-A500) and Cofilin Total (PerkinElmer ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... The uptake reaction was terminated by filtering the samples through a 96 well glass fiber filter (Filtermat B – GF/B, Perkin Elmer) soaked in 1.5% poly(ethyleneimine ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated for 1h in methionine (Met)- and cysteine (Cys)-free DMEM supplemented with 250μCi of 35S-Met/Cys radiolabel (PerkinElmer) per condition at normoxia ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Hoechst (1µg/ml) for 1h at room temperature before washing with PBS and analysing on the Operetta CLS (PerkinElmer). Cells were imaged at 10X using the following channels ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...