Labshake search
Citations for PerkinElmer :
1 - 50 of 740 citations for 5 Isoxazolol 4 methyl 3 trifluoromethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
bioRxiv - Biochemistry 2023Quote: ... to S-adenosyl-L-[methyl-3H]-methionine ([methyl-3H]-SAM) (PerkinElmer)] ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Immunology 2019Quote: ... cyanine 3 and cyanine 5 (Perkin Elmer). The ACD 3-plex negative control probe was run in parallel on separate sections in each experiment to assess the background level and set the acquisition parameter ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
bioRxiv - Immunology 2022Quote: ... [Methyl-14C] Methylated (PerkinElmer Life Sciences), TRIzol (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... [Methyl-3H]-Choline Chloride (Perkin Elmer) (0.3 mCi/kg ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Pathology 2022Quote: ... to [methyl-3H]-SAM (PerkinElmer, Cat#NET155001MC). Reactions were incubated for 1 hr at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... were measured using a radiometric assay that detects transfer of a [3H] methyl from the radio-labeled cofactor S-[Methyl-3H]-adenosyl-L-methionine (SAM, PerkinElmer, cat. NET155001MC) to a biotinylated peptide Akt1-K64 (QCQLMKTERPRPNTFIIRCLQW ...
-
bioRxiv - Biochemistry 2022Quote: ... S-[methyl-3H] (3H-SAM) (PerkinElmer, 18.0 Ci/mmol); and 0.1 μM purified DNMT3A2 in assay buffer (50 mM sodium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 0.76 µM labelled [methyl-3H] -AdoMet (Perkin Elmer) for 3 hours at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... which were incubated with various concentration of synthetic biotinylated TAR-RNA (biotin 5’-dT/GGU CUC UCU GGU UAG ACC AGA UCU GAG CCU GGG AGC UCU CUG GCU AAC UAG GGA ACC/3’-biotin dT) (Integrated DNA Technologies) at 4°C for 3 h in the AlphaLISA buffer (PerkinElmer). Anti-His Donor and Streptavidin Acceptor AlphaLISA beads (PerkinElmer ...
-
bioRxiv - Microbiology 2020Quote: ... 100 µM of 5’-phosphorylated 4-nt primer ACCA (Perkin Elmer) and 5% DMSO containing ERDRP-0519 at the specified concentration ...
-
bioRxiv - Genomics 2023Quote: ... only 100nM were radioactive ([Methyl-3H]-Choline Chloride; Perkin Elmer #NET109001MC), the rest was unlabeled (Choline Chloride ...
-
bioRxiv - Immunology 2021Quote: ... 1 µCi of S-adenosyl [methyl-3H] methionine (0.5 μCi/μl; PerkinElmer) in reaction buffer (500 mM Tris–HCl (pH 7.5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3μM S-adenosyl-L-[methyl-3H] methionine (specific activity 18Ci/mmol, PerkinElmer). For unmodified DNA duplex ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.55μM S-adenosyl-L-[methyl-3H] methionine (specific activity 18Ci/mmol, PerkinElmer), 1.9μM AdoMet in 50mM Tris–HCl ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Microbiology 2021Quote: ... The filters were immersed into 4 ml liquid scintillation cocktail (Optiphase HiSafe 3, Perkin Elmer) and the radioactivity of each filter was measured by a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2021Quote: ... Radioactivity was measured by adding the samples into 4 ml liquid scintillation cocktail (OptiphaseHiSafe 3, PerkinElmer) and counting with a liquid scintillation counter (Wallac Win Spectral 1414 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2.9µM (0.5 µCi) S-[Methyl-3H]-Adenosyl-L-methionine (17.2 mCi/mL, Perkin Elmer)) and incubated at 30 °C ...
-
bioRxiv - Immunology 2021Quote: ... after incubation for 16 h with 1 µCi/ml [methyl-3H]-thymidine (Perkin Elmer). Data were expressed as counts per min (Cpm ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μM S-adenosyl-L-[methyl-3H]methionine (specific activity 18 Ci/mmol, PerkinElmer) in 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.093% of the total choline was radioactive ([Methyl-3H]-Choline Chloride; Perkin Elmer #NET109001MC)(Choline Chloride ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.55 μM S-adenosyl-L-[methyl-3H] methionine (specific activity 58.9 Ci/mmol, PerkinElmer) in 50 mM Tris–HCl (pH 7.2) ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.56 µM S-adenosyl-L-[methyl-3H]methionine with a specific activity of 18 Ci/mmol (PerkinElmer), 1.96 µM nonradioactive SAM ...
-
bioRxiv - Genetics 2020Quote: ... DNA methylation was measured by the incorporation of tritiated methyl groups from radioactively labeled SAM (Perkin Elmer) into the biotinylated substrate using an avidin–biotin methylation plate assay47 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...