Labshake search
Citations for PerkinElmer :
1 - 50 of 738 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µCi of [1-14C] acetate (NEC084H001MC, Perkin Elmer, Waltham, MA, USA) per mL was added and the cells were cultured for four more hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... 14C-acetate (PerkinElmer) 0.5 μCi/0.5mL in the external solution (150 mM NaCl ...
-
bioRxiv - Pathology 2021Quote: ... primary hepatocytes were serum-starved for 3 hours and incubated for 3-hour with [1-14C] acetate (1 μCi/ml; Perkin Elmer, Boston, MA) and 5.5 mM of non-labeled (cold ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 μCi/ml myo-[2-3-H(N)] inositol (PerkinElmer, MA) and indicated treatment conditions ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μM 14C-labeled sodium acetate (PerkinElmer), 50 mM Hepes-KOH ...
-
bioRxiv - Physiology 2020Quote: ... and containing 0.5 μCi [14C]-acetate (PerkinElmer) and 5 μM sodium acetate for 12 h at either 37°C or 31°C ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Neuroscience 2022Quote: ... siScrambled or siAbdc1/2 Astrocytes were incubated overnight with DMEM without glucose supplemented with 1% FBS containing 1 μCi/mL 14C-Acetate ([1-14C] acetate, 58 mCi/mmol, PerkinElmer) and or α-cyclo or 50 μM C26:0 ...
-
bioRxiv - Physiology 2024Quote: ... Supernatant (containing SCFA) was analyzed in duplicate using gas-liquid chromatography (Auto-system XL; Perkin Elmer, Saint-Quentin-en-Yvelines, France). Samples were analysed in duplicate ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Microbiology 2023Quote: ... and immediately exposed to 2μCi/mL 14C-acetate (Perkin Elmer). After incubation at 37°C for 20 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Neuroscience 2020Quote: ... 3H-labeled acetate and 3H-labeled oleate were acquired from PerkinElmer. All chemicals (analytical grade ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 nmol (10 µCi) □1-14C] acetate (Perkin Elmer Life Sciences) were added to each vial and the reaction was stopped after 4 h with 2 ml preheated isopropanol followed by 20 min incubation at 70°C ...
-
bioRxiv - Immunology 2020Quote: ... A volume of 0·1µl supernatant fraction was analyzed for SCFA on a gas–liquid chromatograph (Autosystem XL; Perkin Elmer, Saint-Quentin-en-Yvelines, France) equipped with a split-splitless injector ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A volume of 0.1 µL supernatant fraction was analyzed for SCFA on a gas–liquid chromatograph (Autosystem XL; Perkin Elmer, Saint-Quentin-en-Yvelines, France) equipped with a split-splitless injector ...
-
bioRxiv - Immunology 2021Quote: ... 20 μL of MicroScint-20 (PerkinElmer) was added per filter and counts per minute (cpm ...
-
bioRxiv - Immunology 2021Quote: ... 20 μL of MicroScint-20 (PerkinElmer) was added per filter and cpm were detected with the MicroBeta device (PerkinElmer) ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were incubated with sodium [1-14C]-acetate (final concentration 0.2µCi.ml; Perkin Elmer) for 5 hours at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Microbiology 2022Quote: ... The membranes were incubated with primary and secondary HRP-conjugated antibodies in PBST (5% milk and 0.1% Tween-20) to detect the protein of interest by Western Lightning Plus ECL (PerkinElmer) and ImageQuant LAS 4000 imaging system (GE) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: U937 SLC19A1-/- cell lines (1 × 107 cells) were treated with 21 nM [3H]-L-Arginine (Perkin Elmer) in RPMI SILAC buffer (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA hybridization were performed on dechorionated 20 hpf embryos with the tyramide amplification kit (TSA Plus Cyanine 3 System, Perkin Elmer, Boston, MA). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a DNA loading control also terminating in 20 adenosines (IDT) (Supplementary Table S2) were 5’ labelled with [γ-32P]-ATP (PerkinElmer) using T4 poly-nucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 µM cycloheximide and 10 µCi ml-1 Na-14C acetate (PerkinElmer: 56.6 mCi mM-1) were then added to the culture ...
-
bioRxiv - Plant Biology 2024Quote: ... 10 µM cycloheximide and 10 µCi mL-1 Na-14C acetate (PerkinElmer: 56.6 mCi mM-1) were then added to the culture for the 7-min pulse ...
-
bioRxiv - Plant Biology 2021Quote: ... Seedlings were metabolically labelled with radioactive phosphate by incubating them overnight for ~16-20 hrs with 10 μL (5-10 μCi) carrier-free 32P-PO43- (32Pi; PerkinElmer, The Netherlands) in labelling buffer ...
-
bioRxiv - Cell Biology 2022Quote: Candidate small RNA sequences were identified from raw sequence data using cutadapt (ver. 2.8)21 with parameters “-u -4 -a A(10)” as recommended by PerkinElmer NextFlex Combo-Seq kit ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Microbiology 2021Quote: ... The washed filters were dried for 30 min under a heat-lamp and placed in a 20-ml Borosilicate Glass Scintillation vial containing 5 ml of Ultima Gold F liquid scintillation cocktail (Perkin Elmer, MA, USA). 14C radioactivity retained on the filters was quantified using an LS6500 scintillation system (Beckman Coulter Inc. ...