Labshake search
Citations for PerkinElmer :
1 - 50 of 603 citations for 3 3 17 17 Bis ethylenedioxy 19 hydroxyandrost 5 ene 19 d2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... in 2.8mm ceramic tubes (Cat# 19-628-3; PerkinElmer, Kennesaw, GA) and pre-chilled 700 μl QIAzol Lysis reagent ...
-
bioRxiv - Microbiology 2023Quote: The chemical structure of BI-2051 was drawn with ChemOffice professional 19 suite (PerkinElmer, Waltham, MA), and a three-dimensional (3D ...
-
bioRxiv - Biochemistry 2024Quote: ... and HEPTA were drawn with ChemOffice professional 19 suite (PerkinElmer, Waltham, MA), and three-dimensional (3D ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.25% FA free BSA) and 17 μM [1-14C]oleate (14C-oleate, Perkin Elmer) for 16 hrs ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Genomics 2023Quote: Tissues were homogenized using pre-chilled Omni Bead Ruptor 24 Cryo Cooling Unit (Cat# SKU 19-8005; PerkinElmer, Kennesaw, GA) in 2.8mm ceramic tubes (Cat# 19-628-3 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cyanine 3 (PerkinElmer #NEL744E001KT), and cyanine 5 (PerkinElmer #NEL745E001KT) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cancer Biology 2024Quote: Images of the drug-treated samples (10-17 images per well) were acquired using Opera Phenix High Content Screening System (PerkinElmer) with 40x objective and Andor Zyla sCMOS camera with Harmony High Content Imaging and Analysis Software (PerkinElmer) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
SPNS1 is required for the transport of lysosphingolipids and lysoglycerophospholipids from lysosomesbioRxiv - Biochemistry 2022Quote: ... and lower phase (containing [3-3H]-sphingosine, [3-3H]-ceramides, [3-3H]-SM) were quantified by a scintillation counter (Perkin Elmer Tri-Carb Liquid Scintillation Analyzer).
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 μL γ32P-dATP (Perkin Elmer), and 5 μL H2O for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 3 pM GTP α-32P (PerkinElmer), 10 Units of VCE and incubated 30 min at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.5 ml Optiphase HISAFE 3 (PerkinElmer) was incubated with the filter overnight before liquid scintillation counting with MicroBeta JET (PerkinElmer) ...
-
bioRxiv - Genomics 2022Quote: ... and TSA Plus Cyanine 3 (PerkinElmer). After the last washing step ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Systems Biology 2024Quote: ... Finally 100 μl sample was added to scintillation vials containing 3 mls scintillant (OptiPhase HiSafe 3, Perkin Elmer). β-radioactivity was measured with Tri-Carb 4910TR liquid scintillation counter.
-
bioRxiv - Systems Biology 2020Quote: ... Cy3-TSA (3 min; Perkin Elmer NEL744001KT), Cy5-TSA (7 min ...
-
bioRxiv - Microbiology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Immunology 2021Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μL 35S-labeled methionine (PerkinElmer NEG709A500UC), 2.5 μL recombinant protein (~450ng ...
-
bioRxiv - Microbiology 2022Quote: ... in XIC-3 animal isolation chamber (PerkinElmer) that provided biological isolation of anesthetized mice or individual organs during the imaging procedure ...
-
bioRxiv - Cell Biology 2024Quote: ... TSA Plus Cyanine 3 System (PerkinElmer NEL744001KT) was used to amplify signals generated using antibodies for RBPJ ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 4 minutes after 3 mg d-luciferin (PerkinElmer) was injected intraperitoneally ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-D reconstruction was performed with Volocity (PerkinElmer).
-
bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes.
-
bioRxiv - Immunology 2024Quote: ... mixed with OptiPhase HiSafe 3 scintillation fluid (PerkinElmer) and incubated for 16 hours at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was mixed with Optiphase Hisafe 3 (PerkinElmer), and radioisotope activity was monitored by LSC-8000 β-scintillation (Hitachi) ...
-
bioRxiv - Neuroscience 2020Quote: ... then incubated in TSA plus cyanine 3 (Perkin Elmer) for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The luminescent intensity was measured with VICTOR 3 (PerkinElmer), and the values were normalized to the MAO B protein level measured by Western blotting.
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μCi of [α-32P] CTP (PerkinElmer Life Sciences), 1 mM CTP and was carried out at 37°C for 5 min.
-
bioRxiv - Developmental Biology 2024Quote: ... The lysate was mixed with OptiPhase HiSafe 3 (PerkinElmer), and radioisotope activity was monitored by LSC-8000 β-scintillation (Hitachi ...