Labshake search
Citations for PerkinElmer :
401 - 450 of 603 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Overnight cultures were diluted to an OD600 of ∼0.05 in 10 mL LB Miller broth supplemented with 5 µCi/mL 32P ortho-phosphoric acid (PerkinElmer) and grown until reaching an OD600 of ∼0.6 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were sacrificed 1h post-injection to quantify the fluorescence intensity of the organs ex-vivo with IVIS Lumina III (Perkin Elmer).Average of fluorescent photons per lung were quantify as radiant ef-ficiency [photon/second/cm2/sr] / [µW/cm2] ...
-
bioRxiv - Biochemistry 2021Quote: ... Complexes were incubated for 1h at 37°C and luminescence released by the [14C]-RITA-excited beads was measured in standard microplate reader (Perkin Elmer).
-
bioRxiv - Microbiology 2021Quote: ... The plate was then incubated for 1h at RT in the dark before the AlphaLISA signal was detected using an EnSpire Multimode Plate Reader (Perkin Elmer). Negative control with binding buffer was used to control the assay quality ...
-
bioRxiv - Neuroscience 2021Quote: ... Scintillation fluid was added and filters were agitated for 1h and counted in Wallac Tri-Lux β-scintillation counter (Perkin Elmer). Binding data were analysed by non-linear regression analysis assuming one-site binding (GraphPad Prism 5.0).
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Half of the cell Triton X lysate from each well was pipetted into a scintillation vial and 4 ml of scintillation fluid (#6013329, Ultima GoldTM, Perkin Elmer, USA) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... were prepared in in vitro transcription reaction on linear PCR-generated template containing RNAImod (4) with 500 μM ATP or NAD and 25 μM [α 32P] CTP (Perkin Elmer) using hexa-histidine tagged E ...
-
bioRxiv - Microbiology 2024Quote: ... Mixtures were incubated for 60 min at room temperature prior to adding 4 µl of D-luciferin (30 mg/ml) (Perkin Elmer; #122799). After additional incubation for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Immunology 2024Quote: ... of luciferase activity in each well was measured within 5 min after the addition of substrate using a Victor X4 plate reader (PerkinElmer). After subtracting background luciferase activity in uninfected cells ...
-
bioRxiv - Immunology 2024Quote: ... Fluoforte® fluorescence (excitation 490 nM/emission 525 nM) was quantified at time 0 (baseline) and after 5 minutes on an Envision plate reader (PerkinElmer). Normalized relative fluorescence units (ΔRFU ...
-
bioRxiv - Cell Biology 2024Quote: ... Tem1 (3.3 µM final concentration) was mixed with GTP (33 µM final) supplemented with 5 µCi [α-32P]-GTP (PerkinElmer) in the reaction buffer (20 mM HEPES pH 7.5 ...