Labshake search
Citations for PerkinElmer :
401 - 450 of 1189 citations for 6 Chloro 2 piperazino 1 3 benzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Biochemistry 2020Quote: ... 2 μM mononucleosomes and 5.0 μM S-[methyl-14C]-adenosyl-l-methionine (PerkinElmer, #NEC363050UC) in the presence or absence of stimulatory or control peptides in concentrations as indicated in the text ...
-
bioRxiv - Physiology 2020Quote: ... 0.35 ml of transport solution with 0.5 µCi/ml [3H]2-deoxy-glucose (PerkinElmer) was added to the cells for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli tRNA nucleotidyltransferase and [α-32P] ATP (final activity 2 µCi/µL) (PerkinElmer, # BLU003X250UC) in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 pseudovirus productions were quantified by p24 ELISA (Perkin Elmer Life Sciences).
-
bioRxiv - Molecular Biology 2022Quote: The oligonucleotide substrates (Supplementary Table 2) were 5’-labelled with [γ-32P]ATP (PerkinElmer) and T4 polynucleotidyl kinase (PNK ...
-
bioRxiv - Physiology 2023Quote: ... a bolus injection of 2-[1,2-3H(N)]deoxy-D-glucose (PerkinElmer, Boston, Massachusetts) (0.4 μCi/g body weight ...
-
bioRxiv - Cell Biology 2023Quote: ... The colorimetric reaction was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy H1 microplate reader (BioTek ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 OD600 units of early log phase cells were labeled with 80 mCi of L-[35S]-methionine/cysteine mix (Perkin Elmer). Immunoprecipitated proteins were separated on SDS-PAGE and exposed to phosphor screens ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...
-
bioRxiv - Developmental Biology 2019Quote: ... were used to detect labeled probes by fluorophore deposition (Fluorescein or Cyanine 3) using the TSA Plus System (Perkin Elmer, NEL753001KT). Nuclei were stained with Hoechst 33342 (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both supernatant and lysate were moved to separate counting vials and mixed with 3 mL scintillation fluid (Ultima Gold #6013321, Perkin Elmer). 14C levels were measured in each sample using a Packard Liquid Scintillation Analyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was transferred to a tube and the protein-bound [α-32P]dCTP was quantified in a Beckman Coulter LS 6500 Liquid Scintillation Counter using OptiPhase HiSafe 3 (PerkinElmer) as solvent.
-
bioRxiv - Bioengineering 2021Quote: ... Mice were administered 3.3 mg D-Luciferin in the morning of day 3 and luminescence was recorded after 10 minutes by an In Vivo Imaging System (IVIS, Perkin Elmer) followed by i.v ...
-
bioRxiv - Microbiology 2022Quote: ... The bound calcofluor was measured at excitation (λEx) 350 nm and emission (λEm) of 475 nm with VICTOR 3 1420 Multilabel Counter (PerkinElmer, USA).
-
bioRxiv - Microbiology 2022Quote: ... Animals were anaesthetized using an oxygen-filled induction chamber with 3% isoflurane and bioluminescence was measured using the in vivo imaging system IVIS (IVIS Spectrum Imaging System, Perkin Elmer). Mice were whole-body imaged in dorsal position and the signal intensity was obtained from luciferase expressed in T ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated at restrictive temperature (37°C) for 3 h and finally transfer to 384-well CellCarrier plates (PerkinElmer, 6007550) for imaging on an Opera QEHS high-content screening microscope (PerkinElmer) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Cell toxicity was assessed after 3 h of incubation by measuring fluorescence intensity using the Victor 3V spectrofluorometric multiwell plate reader (Perkin Elmer; excitation at 560 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2020Quote: ... the cultures added with 0.05% v/v DCPK and fluorescent emission for the next 3 hours followed as described in detail in (21) with a Gallios (Perkin Elmer) flow cytometer ...
-
bioRxiv - Neuroscience 2020Quote: ... Imaging was performed at 37°C and 3% CO2 using an Opera Phenix™ high-content confocal microscopy system (Perkin Elmer). Images were acquired at 40x magnification using a 425 nm laser for excitation of CFP and emissions detected at 435-515 nm (CFP ...
-
bioRxiv - Microbiology 2020Quote: ... The dry filter paper was exposed to film for imaging before the individual dots on the filter paper were excised and scintillated with the addition of 3 ml scintillation fluid (Perkin Elmer). Radioactive counts were measured as scintillation counts per minute.
-
bioRxiv - Immunology 2022Quote: ... β-radioactivity was measured by liquid scintillation counting in a Beckman LS 6500 Multi-Purpose Scintillation Counter (scintillant Optiphase HiSafe 3; PerkinElmer, #1200.437). L-Alanine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... 12 pictures of at least 3 biological replicates were quantified using the Harmony high-content imaging and analysis software (Perkin Elmer).
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide probes (listed in Supplementary file 3) for the different RNAs were labelled with 0.3 mCi of [γ-32P] ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: NMuMG cells expressing either EGFP-BIK-L61G or EGFP-PUMA4E were seeded (3,000 cells per well) in multiple wells (at least 3) of a 384-well microplate (CellCarrier-384 ultra, B128 SRI/160; Perkin Elmer) and allowed to grow for 24 h before staining with the nuclear dye DRAQ5 (5nM ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 pmol of DNA oligonucleotide (Eurofins MWG Operon, Germany) were 3’-end labelled with 3.3 pmol of α-32P-dATP (Perkin Elmer) using terminal deoxynucleotidyl transferase (TdT ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Immunology 2024Quote: Bacterial burden in MRSA /ux-infected mouse ears was monitored every 24 h for 3 or 7 consecutive days using an In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer). Bacterial burden was quantified as the bioluminescence (radiance ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Immunology 2021Quote: ... was added for 2 minutes before reading with a PerkinElmer Envision instrument (PerkinElmer, Waltham, MA). 50% neutralization titer (ID50 ...
-
bioRxiv - Neuroscience 2021Quote: ... d(CH2)5 [Tyr(Me)2,Thr4,Orn8,(125I)Tyr9-NH2] (125I-OVTA, PerkinElmer, Inc.). An adjacent series of slides ...
-
bioRxiv - Cancer Biology 2020Quote: ... Multiplex stained slides were imaged using the Vectra Multispectral Imaging System version 2 (Perkin Elmer). Filter cubes used for multispectral imaging were DAPI (440–680 nm) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 pmol of DNA was incubated with 2 μL 5mCi [γ32-P]ATP (Perkin Elmer) and 4 μL T4 polynucleotide kinase (New England BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... PRKACA inhibiting activity was screened using the EZ Reader 2 electrophoretic mobility shift platform (PerkinElmer). PRKACA enzyme (0.007 ng/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... The washed sepharose was then directly added to 2 mL Ultima GoldTM scintillation cocktail (PerkinElmer). Radioactivity was read by a Tri-Carb 2910TR scintillation counter (PerkinElmer) ...
-
bioRxiv - Neuroscience 2020Quote: ... Radioactivity of the filter paper was measured in a Microbeta 2 Scintillation Counter (Perkin Elmer) after addition of 3 mL Ultima-Gold Scintillation Fluid ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 pmol of DNA was incubated with 2 μL 5 mCi [γ32-P]ATP (PerkinElmer) and 4 μL T4 PNK (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... Infected cells were lysed 2 days after infection with a britelite plus (PerkinElmer, Cat#6066769), and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Physiology 2024Quote: ... Filters were dissolved in 2 ml liquid scintillation fluid (Filter Count, PerkinElmer, Waltham, MA, USA) and counted ...
-
bioRxiv - Cell Biology 2020Quote: ... The blot was washed in TTBS for 3 times and the signal was developed using Western Lightening Plus-ECL kit (PerkinElmer, Waltham, MA) and detected on HyBlot CL X-ray films (Denville).
-
bioRxiv - Molecular Biology 2021Quote: ... The plates were read at a wavelength of 460 nm using the VICTOR 3 V 1420 Multi-Label Microplate Reader (Perkin Elmer, USA). All reactions were carried out in triplicate using both antigenic peptides in separate experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Imaging involving mNG-Bud8 (Figs. 3 & S2) was performed using a spinning disk confocal microscope (Ultra-VIEW VoX CSU-X1 system; Perkin Elmer-Cetus) equipped with a 100x /1.45 NA Plan-Apochromat Lambda oil immersion objective lens (Nikon) ...