Labshake search
Citations for PerkinElmer :
401 - 450 of 1362 citations for 6 Chloro 2 methyl 1 2 4 triazolo 4 3 b pyridazin 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Each mouse received 2 nmol of MMPSense 680 (150 μl; Perkin Elmer, France) or Cat K 680 FAST™ (100 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the wells before addition of 2-[3H]deoxyglucose (2DG) (PerkinElmer). During the final 5 min 2DG (0.25 μCi ...
-
bioRxiv - Cancer Biology 2019Quote: ... and luminescence was measured with Perkin Elmer Victor-2 Plate Reader (PerkinElmer Inc.).
-
bioRxiv - Cancer Biology 2020Quote: ... and imaged/analysed using the Vectra 2 System (PerkinElmer Inc., Waltham, MA, USA). The RAD51 Vectra score (RAD51Vs ...
-
bioRxiv - Neuroscience 2021Quote: ... and HPLC fractions were counted with automatic gamma well-counter (Wizard 2, PerkinElmer). The sample recovery rate ...
-
bioRxiv - Bioengineering 2022Quote: ... Activity in all samples was assessed via gamma counter (Wizard 2, Perkin Elmer) once decayed to a linear range ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Plant Biology 2023Quote: ... and 750 nm using a spectrophotometer (Perkin Elmer UV/VIS spectrometer Lambda 2). The pigment contents were calculated according to the equation given by Wellburn ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human IL-2 concentration was measured with the AlphaLISA human IL2 Kit (PerkinElmer) and data collected on an Envision Plate Reader (PerkinElmer) ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then read in a Wallac Victor 2 fluorimeter (Perkin Elmer) with excitation at 355 nm ...
-
bioRxiv - Cancer Biology 2023Quote: ... blots were developed in 2 mL Western Lighting Plus chemiluminescent substrate (Perkin Elmer) and imaged on the ImageQuant LAS4000 (Cytiva).
-
bioRxiv - Cell Biology 2023Quote: ... Luminescence signal was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy h1 microplate reader (BioTek ...
-
bioRxiv - Cell Biology 2019Quote: ... eluted proteins were incubated overnight at 4 °C and measured with a microplate reader analyzer (EnVision, PerkinElmer). Excitation spectra were obtained collecting emission at 515 ± 15 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... 300 μl of each supernatant were mixed with 4 ml of Ultima Gold liquid scintillation cocktail (PerkinElmer) and run on a Hidex SL300 counter ...
-
bioRxiv - Zoology 2019Quote: ... to which 4 mL of scintillation fluid (Emulsifier-Safe cocktail, Cat. No. 6013389, Perkin Elmer, Groningen, Netherlands) was added ...
-
bioRxiv - Plant Biology 2023Quote: ... The same seeds were transferred into weighing cup and weighed with an AD-4 Autobalance (PerkinElmer, Inc.). Single seed weight was subsequently determined by dividing the total weight by the number of seeds.
-
bioRxiv - Pathology 2023Quote: ... The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT, PerkinElmer). All pictures were taken with a Zeiss Axioplan 2 microscope ...
-
bioRxiv - Immunology 2021Quote: ... were plated in 3 ml of complete medium supplemented with IL-2 (20 IU/ml) and incubated with 1 μl of 3H-labeled ROL (PerkinElmer, Boston, MA, USA) for 4 h ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... lung tissues harvested from euthanized mice were soaked for 10 min in pre-warmed (37°C) PBS with 2% FBS and a 1:10 dilution of Xenolight RediJect Coelenterazine h (Cat# 706506, Perkin Elmer, Waltham, MA). Following a 12-15 min incubation ...
-
bioRxiv - Cell Biology 2019Quote: ... Acquisition was performed on at least 1000 cells per well (3 wells per condition) with 20X objective with Harmony Imaging Software 4.1 (Perkin Elmer). Image analysis was pursued using Colombus 2.5.0 software (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2019Quote: ... was performed at 24 and 72h (n=3) and cells were imaged using Operetta CLS high-content screening system (PerkinElmer) using 10x magnification and filters for calcein and EthD detection ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... Images were acquired at 1 frame/6-10 s and analyzed using Volocity (PerkinElmer) and NIH ImageJ ...
-
bioRxiv - Immunology 2021Quote: ... Plasma 2-[1-14C]-Deoxy-D-glucose radioactivity was directly measured in a liquid scintillation counter (Tri-Carb 2810 TR, Perkin Elmer, Waltham, MA, USA). Tissue lysates were processed through ion exchange chromatography columns (Bio Rad Laboratories Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... and all qualitative imaging of Kif19 plasmids were conducted on a 4-D spinning-disk confocal microscope (PerkinElmer) with 60x (1.4 NA ...
-
bioRxiv - Molecular Biology 2019Quote: ... exponentially growing 4×105 HEK293T cells were cultured 90 min with 200 µCi/ml [S35]-methionine (Perkin Elmer) in methionine and cysteine-free DMEM containing 100 µg/ml of emetine ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET measurements were routinely performed following overnight incubation at 4°C using an EnVision Reader (Perkin Elmer). Values were collected as the background subtracted ratio between fluorescence emission at 665 nm and 615 nm where the background signal corresponds to the ratio (665/615 ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Plant Biology 2022Quote: ... dissolved in 0.1% nitric acid and 4 mL Optima Gold XR scintillant (Perkin Elmer, Glen Waverley, VIC, Australia) was added prior to counting for two minutes using a Liquid Scintillation Counter (LS6500 ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...