Labshake search
Citations for PerkinElmer :
351 - 400 of 1066 citations for Mouse ATP Synthase Coupling Factor 6 Mitochondrial ATP5J ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... After 10min of incubation at 37°C supernatants were collected and concentration of ATP/sample was measured using ATPlite Luminescence Assay System (PerkinElmer) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNA flanking sequences are: TCGAGCATTATATGAAC-sgRNA-GGGTATTGGGGAATTCATTATGC) was labeled with 32P gamma-ATP (6000 Ci/mmol, 25 µM, Perkin Elmer) with PNK (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Change in initial ATP concentration was measured as bioluminescence readout in counts per second on the Envision plate reader (PerkinElmer).
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-[3H]-DA (Perkin Elmer Life Sciences, USA) as previously described (Jensen et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-[3H]-DA (Perkin Elmer Life Sciences, USA) was used to obtain saturation DA uptake curves ...
-
bioRxiv - Biochemistry 2023Quote: The expression of IL-6 and TNF-α in culture supernatants was detected using the corresponding AlphaLISA Immunoassay Kit (PerkinElmer, AL223C and AL208C) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2019Quote: ... 14 and 21 for HIV-1 p24 antigen levels by ELISA (Perkin Elmer, Boston, MA).
-
bioRxiv - Cell Biology 2019Quote: ... Viral titer was determined using p24 ELISA test measuring viral capsid protein p24 (Perkin Elmer, performed in Biomedicum Functional Genomics Unit) ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 100-bp mini-circle was prepared as follows: oligos cb1027 and cb1028 were labeled with [γ-32P]-ATP (Perkin Elmer) by T4 polynucleotide kinase ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... For the analysis of Dscam and elav alternative splicing primers were labeled with 32P gamma-ATP (6000 Ci/ mmol, 25 mM, Perkin Elmer) with PNK to saturation and diluted as appropriate 69 ...
-
bioRxiv - Genomics 2020Quote: ... 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 40 µM ATP, 40 µM GTP, 40 µM Biotin-11-CTP [Perkin Elmer] ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mL of cells from each culture pulsed with 1 μCi [γ32P]-ATP having a specific activity of 30 Ci/mmol (Perkin Elmer) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... 10% (v/v) glycerol) supplemented with 200 μCi ml−1 (65 nM) of [γ-33P]ATP (PerkinElmer, 3000 Ci mmol−1) for 10 minutes at room temperature in order to obtain the optimal FrzECheA autophosphorylation activity ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide probes (listed in Supplementary Table S2) were 5′ 32P-end labeled with 0.3 mCi of γ-32P ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the reactions were rapidly diluted in a saturating concentration of ATP and the TR-FRET signal was measured continuously in a multiplate reader Envision (Perkin Elmer).
-
bioRxiv - Cell Biology 2019Quote: ... GST-Aq-NF-κB or GST-Aq-NF-κB-ALA C-terminal peptides and 5 μCi [γ-32P] ATP (Perkin Elmer) in kinase reaction buffer (25 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2020Quote: ... The 500 nM annealed DNA substrates were then radiolabeled in PNK buffer with PNK enzyme and radioactive ATP [γ32P] from Perkin Elmer at 37°C for 1 hr then diluted in TE buffer (10 mM Tris ...
-
bioRxiv - Plant Biology 2020Quote: ... was incubated with oligonucleotide probes (0.01 pmol-10 fmol) 5’-radiolabeled with [y-32P]ATP (5000 Ci/mmol; PerkinElmer Life Science). Different dsDNA structures were prepared by annealing the radiolabeled sense oligonucleotides with a twofold excess of unlabeled complementary oligonucleotide and purified on non-denaturing polyacrylamide gels ...
-
bioRxiv - Microbiology 2019Quote: The membrane was hybridized overnight at 50°C with DNA oligo probes labeled with [gamma- 32P]-ATP (6000 Ci/mmol) (Perkin Elmer). 20 pmol of the DNA oligo was mixed with 7 μl of [gamma- 32P]-ATP ...
-
Surveying the landscape of tRNA modifications by combining tRNA sequencing and RNA mass spectrometrybioRxiv - Biochemistry 2019Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42 °C with 4 pmol DNA probes radiolabeled with [γ-32P]ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42°C with 4 pmol probes (Table S3) that were radiolabeled using [γ-32P] ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: 643nt pre-crRNA was in vitro transcribed with [a-32P]-ATP (10 mCi ml-1, 3000 Ci mmol-1, Perkin Elmer) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a DNA loading control also terminating in 20 adenosines (IDT) (Supplementary Table S2) were 5’ labelled with [γ-32P]-ATP (PerkinElmer) using T4 poly-nucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... and the emitted light corresponding to the amount of ATP was measured in a Victor® XLight Multimode Plate Reader (PerkinElmer). For each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... the reaction was initiated by the addition of 3 μl of 2 mM [ψ-32P]ATP (222 TBq/mmol Perkin Elmer) to the mixture (final concentration ...
-
bioRxiv - Microbiology 2023Quote: ... Oligonucleotide probes (listed in Supplementary file 3) for the different RNAs were labelled with 0.3 mCi of [γ-32P] ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubation with a 32P-labelled oligodeoxyribonucleotide probe complementary to the target RNAs (32P-labelled using T4 polynucleotide kinase and [g 32P]-ATP [Perkin Elmer]) overnight in 37°C in SES1 buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transcription was initiated with addition of 12 pmol rrnBP1 PCR promoter fragment pre-mixed with 1 mM ATP and 4 μCi α-[32P]-CTP (3,000 Ci mmol−1; Perkin Elmer) at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then incubated for 72h and the ATP content of every well was assessed on the Plate Reader Platform Victor X3 model 2030 (Perkin Elmer) using the CellTiter-Glo assay (Promega G7573) ...
-
bioRxiv - Microbiology 2021Quote: ... and Volocity 6 software (PerkinElmer Life Sciences, Boston, USA) was used to process images.
-
bioRxiv - Cell Biology 2023Quote: ... containing 6 ml Ultima Gold scintillation cocktail (Perkin Elmer). Radiation in each sample was measured as counts/minute (CPM ...
-
bioRxiv - Cell Biology 2019Quote: ... Plates were left at room temperature for 10 min before imaging the ATP-coupled luminescence using a ViewLux microplate imager (PerkinElmer, Waltham, MA).
-
bioRxiv - Genomics 2020Quote: ... 300 mM KCl, 40 µM ATP, 40 µM GTP, 40 µM Biotin-11-CTP [Perkin Elmer], 40 µM Biotin-11-UTP [Perkin Elmer] ...
-
bioRxiv - Biochemistry 2021Quote: ... and SL5 generated via in vitro transcription were treated with Quick Calf Intestinal Alkaline Phosphatase before labeling with [γ-32P]-ATP (Perkin Elmer) and T4 PNK ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Then it was mixed with reaction B which contain 5 μg of the GST-substrate in 5x Kinase buffer containing 2 μCi γ-32P-ATP (PerkinElmer, BLU002Z250UC) in 10-μl reactions ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... at 37°C for 1 h in a reaction containing 20 pmol probe, 1X T4 PNK Reaction Buffer, 50 pmol [γ-32P]-ATP (7000 Ci/mmol, 150 mCi/ml)(PerkinElmer, NEG002Z250UC). For hybridization ...
-
bioRxiv - Molecular Biology 2020Quote: 100 pmol of WT or mutant RNA oligonucleotides (synthesized by Integrated DNA Technologies, Inc.) were 5’- end labeled with [γ32P] ATP (Perkin Elmer, NEG035C001MC) and T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... the R2R and primer extension (PE) DNA primers (100 pmol) were labeled with [γ-32P]ATP (125 pmol; 6,000 Ci/mmol; 150 μCi/ μl; PerkinElmer Life Sciences) by incubating the DNA with T4 polynucleotide kinase (10 units ...
-
bioRxiv - Molecular Biology 2023Quote: ... were prepared in in vitro transcription reaction on linear PCR-generated template containing RNAImod (4) with 500 μM ATP or NAD and 25 μM [α 32P] CTP (Perkin Elmer) using hexa-histidine tagged E ...
-
bioRxiv - Microbiology 2020Quote: ... ELISA absorbance was read at 450nm for 0.1 second on a Victor X5 plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2019Quote: ... ELISA plates were read at 450 nm using a Wallac 1420 Victor2 Microplate Reader (Perkin Elmer, provided by Don Jarvis at the University of Wyoming) ...
-
bioRxiv - Microbiology 2023Quote: ... 0.45 µm-filtered and used for HIV-1 CAp24 quantification by ELISA (released CAp24) (Perkin Elmer). Cell lysates were analyzed by western blotting.
-
bioRxiv - Biochemistry 2021Quote: ... alone or in the presence of 100 μM Na2S was assayed for its ability to autophosphorylate in a reaction containing 50 µCi of [γ-32P]-labeled ATP (6000 Ci/mmol, PerkinElmer Health Sciences), 100 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: In vitro kinase reactions were developed in a final volume of 50 μl containing 0.02 mM [γ-32P]ATP (1 µCi per tube, Perkin Elmer, Massachusetts, USA), 50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: U10 and CUGCUGUUUU (20 pmol) were chemically synthesized (Integrated DNA Technologies (IDT)) and 20 pmol RNA was radioactively labeled using [γ-32P]-ATP (PerkinElmer, 10mCi/ml) and 10 units T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Immunology 2023Quote: ... T lymphocyte migration from the upper plate towards chemoattractant solution in the receiver plate was quantified via the ATP detection assay (Perkin Elmer, Waltham, MA). In parallel with the multiscreen assay ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... supernatants were collected and IL-6 assayed with AlphaLISA (PerkinElmer) using the manufacturer’s instructions.