Labshake search
Citations for PerkinElmer :
351 - 400 of 1101 citations for E 7 Bromo 3 4 dihydrobenzo b oxepin 5 2H one O 2 2 2 trifluoroethyl oxime since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Biochemistry 2020Quote: ... and 7 μCi [35S]-Methionine/cysteine (PerkinElmer; NEG072007MC) and labelled for 2 hours ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The filter paper was dried and added to a vial containing Opti-Fluor® O (Perkin Elmer). Radioactivity on the filter papers was determined using a liquid scintillation counter (Perkin Elmer).
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored every 3-4 days by non-invasive luciferase imaging by intraperitoneal injection of 150 mg/kg Luciferin (PerkinElmer) and quantification of luciferase activity using Imaging Systems (IVIS Spectrum System ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µL of RNA was 3’-end-labeled with 32pCp (prepared by incubating 16.5 µl of γ-32P-ATP (PerkinElmer), 1 µl of T4 polynucleotide Kinase ...
-
bioRxiv - Biophysics 2023Quote: ... The uptake reaction was terminated by filtering the samples through a 96 well glass fiber filter (Filtermat B – GF/B, Perkin Elmer) soaked in 1.5% poly(ethyleneimine ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... 150 μL 14C-labelled lipids from the denser organic fraction were combined with 4 mL OptiPhase HiSafe 3 liquid scintillation cocktail (PerkinElmer; 1200.437) and radio-labeling was quantified using a Tri-Carb 2910 TR Liquid Scintillation Analyzer (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT (1.5 × 104) cells expressing DSP1–7 (293FT/DSP1–7) were plated in 96-well plates (Perkin Elmer Life Sciences, Waltham, MA, USA) with DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Emission signal was collected using a liquid crystal tunable filter (LCTF) (VariSpec VIS-7-35, PerkinElmer, Inc. Waltham, MA, USA, 7 nm bandwidth) programmed to collect at 515 nm and a high-resolution dual-modal charge-coupled device (CCD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... merged into one plane using Openlab software (PerkinElmer) and processed further in Photoshop (Adobe) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were split again on days 4 or 5 as needed into a 96-well imaging plate (Perkin Elmer). A half media change was performed every other day if cells were not being split ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7 mCi of γ-32P-ATP (PerkinElmer, 3000 Ci/mmol), and either DMSO or 2 μM of the Cdk4/6-inhibitor Palbociclib (Selleckchem ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Plates were incubated at room temperature for 2h before measurement of the fluorescence using an EnVision Multimode Plate (Reader PerkinElmer Life and Analytical Sciences). All values were converted to cAMP concentration using cAMP standard curve performed parallel and data were subsequently normalized to the response of 100μM forskolin in each cell line ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Microbiology 2024Quote: ... Specific absorbance (safranin-O) or fluorescence (WGA and resazurin) was measured using an EnSight spectrophotometer (Perkin Elmer, Villepinte, France). An average of at least 12 biofilm replicates were performed for each individual ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were sealed using parafilm and aluminium foil until analysis (November 2017, University of Geneva) using an Elemental Analyzer (2400 series II CHNS/O Elemental Analysis, PerkinElmer). Procedural blanks using MilliQ water were performed (24-25 November 2017 ...
-
bioRxiv - Neuroscience 2022Quote: ... The GF/C filterplates were dried at 52°C and 25 μl Microscint-O was added to each well to quantify radioactivity using a Microbeta Wallac Trilux scintillation counter (PerkinElmer). Saturation binding of [3H]histamine was measured with increasing concentrations of [3H]histamine in the absence or presence of 50 microM JNJ7777120 to detect total and nonspecific binding respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... and analyzed for total N content using an NC analyzer (Series II CHNS/O Analyzer 2400; PerkinElmer, Waltham, MA, USA).
-
bioRxiv - Microbiology 2024Quote: ... and β-galactosidase activity (o-nitrophenol) was measured through absorption at 405 nm (OD405) using a Victor Nivo multimode plate reader (PerkinElmer). The results were normalized to measurements from the positive (pKT25-zip + pUT18C-zip ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transcripts were labeled with the Opal 7 Kit (Perkin Elmer, NEL797001KT): Opal 520 (1:1500) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 3’TAMRA fluorescence from 5’UAR was recorded by a single molecule avalanche photodiode (SPAD) (SPCM-AQR-14, PerkinElmer Optoelectronics, Quebec, Canada), through a 600/50 band pass emission filter ...
-
bioRxiv - Biochemistry 2023Quote: ... Filter-bound [3H]VUF15485 was measured by adding 25 µL Microscint-O per well to the dried GF/C-plate and radioactivity was consecutively quantified using the Wallac Microbeta counter (Perkin Elmer). The sigmoidal dose-dependent displacement curves of [3H]VUF15485 binding by unlabelled ligands were analysed using Graphpad Prism 8 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filter-bound [3H]VUF15485 was measured by adding 25 µL Microscint-O per well to the dried GF/C-plate and radioactivity was quantified using the Wallac Microbeta counter (Perkin Elmer).
-
bioRxiv - Microbiology 2022Quote: ... were performed in a HORIBA JOBIN YVON Spectrofluorometer (FluoroMax – 4) (HORIBA Scientific, Edison, New Jersey, USA) in a fluorescence cuvette of path length 5 mm (Perkin Elmer B0631123), after putting 0.5ml of the sample solution in it ...
-
bioRxiv - Developmental Biology 2021Quote: ... cyanine 3 (PerkinElmer #NEL744E001KT), and cyanine 5 (PerkinElmer #NEL745E001KT) ...
-
bioRxiv - Cell Biology 2021Quote: ... Imaging was done with temperature-controlled Nikon Ti-E Eclipse inverted/UltraVIEW VoX (Perkin Elmer) spinning disc confocal setup ...
-
bioRxiv - Microbiology 2022Quote: ... This was followed by addition of MicroScint O scintillation cocktail and incorporation of 3H-hypoxanthine was measured using a TopCount scintillation counter (PerkinElmer Life-sciences).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Filter plates were dried overnight and radioactivity was determined by the addition of 40 μL of MicroScint-O scintillation fluid and counting in a MicroBeta2 Plate Counter (PerkinElmer Life Sciences).
-
bioRxiv - Microbiology 2020Quote: ... the mixtures were spotted onto filtermat B (Perkin Elmer, cat#1450-521) soaked in 0.5% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The reactions were terminated through filtration with GF/B filters (Perkin Elmer) using a 96-well plate harvester (Brandel) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The viability was measured with ATPlite One Step reagent (Perkin Elmer) after 48h of the treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... one neurosphere was plated per well of 96 well plates (PerkinElmer) previously coated with 100 μg/ml polyornithine and 20 μg/ml laminin at days 3 and 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... Opal570 (1:500) and Opal650 (1:1500) using the Opal 7 Kit (PerkinElmer).
-
bioRxiv - Neuroscience 2024Quote: GT1-7 and N46 cells were plated on 96-well plates (PerkinElmer, #6055302). Cells were treated with DMEM (Multicell ...
-
bioRxiv - Plant Biology 2020Quote: ... and a 2 mg subsample was analyzed for carbon and nitrogen content using a CHN elemental analyzer (2400 CHNS/O Series II, PerkinElmer, Waltham, MA, USA). Each 30 cm of the entire root system ...
-
bioRxiv - Biochemistry 2024Quote: Fluorescence was measured using the Luminescence Spectrometer L 50 B from Perkin Elmer. Spectra were recorded with an excitation wavelength of 280 nm using a 5 x 10 mm cell at 25 °C with excitation and emission slits of 3 and 5 nm ...
-
bioRxiv - Immunology 2020Quote: A Fourier transform infrared spectroscopy (FTIR) spectrophotometer (Spectrum One, PerkinElmer, Inc., Waltham) was employed to measure the FTIR spectra of the samples ...
-
bioRxiv - Biochemistry 2023Quote: ... The assay was conducted using the IP-One Gq kit (Perkin Elmer) according to the protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Opal570 (1:500) and Opal650 (1:1500) using the Opal 7 Kit (NEL797001KT; PerkinElmer).
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were monitored for 7 days and imaged by Xenogen IVIS spectrum (PerkinElmer, Massachusetts) camera to document engraftment before treatment was initiated ...