Labshake search
Citations for PerkinElmer :
351 - 400 of 1612 citations for 6 4 Methyl 1 piperazinyl N 5 methyl 1H pyrazol 3 yl 2 1Z 2 phenylethenyl 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and Hoechst (1µg/ml) for 1h at room temperature before washing with PBS and analysing on the Operetta CLS (PerkinElmer). Cells were imaged at 10X using the following channels ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Immunology 2022Quote: ... L-[3,43H(N)]-glutamine (3H-glutamine; PerkinElmer, #NET551001MC) uptake was carried out using 1 million cells resuspended in 0.4 mL HBSS (Thermo ...
-
bioRxiv - Biochemistry 2023Quote: ... [9,10-3H(N)]-triolein was obtained from PerkinElmer Life Sciences (Waltham ...
-
bioRxiv - Biophysics 2021Quote: ... Cell fixation was performed 24h after transfection using 4% formaldehyde and cellular imaging was performed using an Operetta CLS (PerkinElmer). Three individual plate preparations were used as independent experiments for statistical significance (n=3) ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 4 h at 37°C and fluorescent signal intensity was quantified using the EnSpire Multimode Plate Reader (PerkinElmer) at excitation and emission wavelengths of 540 and 612 nm respectively.
-
bioRxiv - Molecular Biology 2020Quote: ... The protein pellet was then re-suspended in PBS and incubated in 4 mL of scintillation fluid (Insta-Gel Plus, PerkinElmer) for 24 h (to homogenize the samples ...
-
bioRxiv - Biophysics 2020Quote: ... separated free and bound radioligand and the radioactivity on each filter determined by the addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and count using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... To quantify α1-3;5GABAAR79 sections were incubated for 60 minutes at 4°C in 1nM [3H]flumazenil (Perkin Elmer, NET757001MC), or in 1nM [3H]flumazenil with 10 µM flunitrazepam (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA samples were separated on a 7 M urea denaturing polyacrylamide gel at 4°C at 100V and transferred onto a charged nylon transfer membrane (PerkinElmer), followed by cross-linking using a UV Stratalinker and drying at 80°C on a Gel Dryer (Bio-Rad).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Aerrane (Isoflurane, Baxter) inhalation was performed for anesthesia using the RAS-4 Rodent Anesthesia System (Perkin Elmer, Waltham, MA, USA) for experiments with IVIS Spectrum CT living imaging system (Perkin Elmer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed with PBS and then stored in PBS at 4°C until imaged in the Opera Phenix (PerkinElmer) at 40x magnification and images analysed using a Harmony software to assess protein expression and morphology (see supplementary).
-
bioRxiv - Pathology 2023Quote: ... double immunohistochemistry for paraffin sections (8 μm) was conducted by using the Opal 4 color manual immunohistochemistry (IHC) kit (NEL810001KT, PerkinElmer). The signal of p-MLC2 was amplified by the Opal 4 color manual IHC kit (NEL810001KT ...
-
bioRxiv - Bioengineering 2024Quote: ... The plates were incubated for 4 h at 37°C and then the supernatant was removed and incubated with scintillation fluid (PerkinElmer) overnight at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then separated on a HayeSep column (7’ HayeSep N 1/8’’ Sf; PerkinElmer Inc., Waltham, USA), followed by molecular sieve (9’ Molecular Sieve 13x 1/8’’ Sf ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Perkin Elmer, #AL000F). A 2-fold serial dilution of imiglucerase (Genzyme ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Samples were diluted 1/5 or 1/10 in 1X Immunoassay buffer (Cat.#AL000F; PerkinElmer). For calibration ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity was read approximately 2 min later using a Wallac Victor3 plate reader (Perkin Elmer). 50% ADCC titers were estimated as previously described for virus neutralization assays (41) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 500 µM ATP (with 2 μCi of [γ-32P] ATP added per reaction; PerkinElmer BLU502Z250UC). Phosphorylated proteins were separated on 10% SDS-PAGE gels unless stated otherwise ...
-
bioRxiv - Physiology 2020Quote: ... Cells were incubated with 50 μM 2DG containing 0.25 μCi 3H-2-deoxyglucose (2DG, Perkin Elmer) for 5 min and washed three times with cold PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Isolated cardiac myocytes were incubated with 0.1 mM [1,3-3H]glycerol (2 μCi/dish, Perkin Elmer) or 0.1 μM [1-14C]linoleic acid (2 μCi/dish ...
-
bioRxiv - Neuroscience 2023Quote: ... Isotope content was determined in 2 ml Ultima Gold™ XR scintillation liquid (6013119, Perkin Elmer) using the Tri-Carb 2900TR Liquid Scintillation Analyzer (Packard) ...
-
bioRxiv - Cell Biology 2024Quote: ... The organs were harvested and imaged using the IVIS Lumina XRMS Series 2 instrument (PerkinElmer, USA) to assess the biodistribution of mannose ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Neuroscience 2020Quote: ... and TSA® Plus Cyanine 5 (1:1000, Perkin Elmer NEL745E001KT) evaluation kits ...
-
bioRxiv - Immunology 2020Quote: ... Plates were stored in the dark at 4°C prior to imaging using a 40x objective mounted on an Operetta High-Content Imaging System (Perkin Elmer) controlled by Harmony 4.1 software.
-
bioRxiv - Cell Biology 2021Quote: ... diluted in buffer A to a final concentration of 4 nM) was added to a 384-well microplate (OptiPlateTM-384 Plus, Perkin Elmer) followed by the addition of 15 μL diluted proteins and 5 μL of the GFP antibody-conjugated acceptor beads (5x) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were prehybridized and hybridized at 45°C for 4 hours in 50% (Vol/Vol) formamide hybridization buffer containing 35S-labeled antisense RNA probes (Perkin Elmer). RNase A-resistant hybrids were detected by autoradiography ...
-
bioRxiv - Plant Biology 2022Quote: ... 5-mm root segments away from the apical 2 mm root tip and 2 mm away from the root-shoot junction were carefully cut and soaked overnight in 4 ml of liquid scintillation fluid (Ultima Gold, PerkinElmer, USA), and the radioactivity was measured with a scintillation counter (model LS6500 ...
-
bioRxiv - Physiology 2020Quote: ... Each filter was then placed in a Sterilin™ scintillation vial and radioactivity determined by: addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and the retained radioactivity determined using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
Surveying the landscape of tRNA modifications by combining tRNA sequencing and RNA mass spectrometrybioRxiv - Biochemistry 2019Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42 °C with 4 pmol DNA probes radiolabeled with [γ-32P]ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... at 42 °C for 30 min followed by hybridization overnight at 42°C with 4 pmol probes (Table S3) that were radiolabeled using [γ-32P] ATP (PerkinElmer) and T4 Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were cut as 4 μm sections and automated IF was performed on a Leica Bond Rx Platform at room temperature using the PerkinElmer Opal 4-Colour Automation IHC Kit (PerkinElmer, #NEL800001KT). Tissue sections were blocked with 3% Hydrogen peroxide (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... media was changed to low-glucose DMEM supplemented with an additional 25 μM unlabelled phenylalanine and 4 μL of [14C]phenylalanine (NEC284E050UC; Perkin Elmer) per mL for 6 h ...
-
bioRxiv - Microbiology 2021Quote: ... L-[3,4,5-3H(N)] (cat. NET460A005MC, PerkinElmer, MA, USA). To reduce the potential for autodegradation of the leucine radiolabel ...
-
bioRxiv - Immunology 2020Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 6 software (Perkin Elmer, Courtaboeuf, France).
-
bioRxiv - Immunology 2019Quote: ... 2 × 103 cells were plated in pre-coated 96 well plates (CellCarrier-96 Ultra Microplates, black, PerkinElmer) following the same procedure.
-
bioRxiv - Systems Biology 2021Quote: ... columns 2-23 were used) of tissue-culture treated black CellCarrier-384 Ultra Microplates (Perkin Elmer 6057302) using a 12-channel electronic multichannel 200 μL pipettor [Sartorius] ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Cell Biology 2020Quote: ... and the wells were covered immediately using filter papers soaked with hyamine hydroxide (Perkin Elmer, 2-19361). After incubation in a fume hood for at least 12 hours to reach saturation ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were loaded with 2 μCi/ml D-[2,3-3H]aspartate (Perkin Elmer, Waltham, MA, cat. #NET50100) in MEM +HIHS cell culture medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µL of cell culture medium or standard solution was added to an Optiplate-384 microplate (PerkinElmer). 21µL of 10X mixture including acceptor beads and biotinylated antibody was then added to the wells with culture media or standard solution ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... the sections were incubated with diluted TSA plus Cy-3 (1:750, PerkinElmer, #NEL741001KT) for 30 minutes at 40°C in the oven ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were sacrificed 1h post-injection to quantify the fluorescence intensity of the organs ex-vivo with IVIS Lumina III (Perkin Elmer).Average of fluorescent photons per lung were quantify as radiant ef-ficiency [photon/second/cm2/sr] / [µW/cm2] ...