Labshake search
Citations for PerkinElmer :
351 - 400 of 661 citations for 4 Chloro 2 fluoro 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
bioRxiv - Physiology 2021Quote: ... where whole-body glucose flux was traced by infusion of 0.05 μCi/min D-[3-3H]-glucose (Perkin Elmer), after a priming 5 μCi bolus for 1 minute ...
-
bioRxiv - Physiology 2020Quote: ... The fluorescence signal was developed with tyramide signal amplification (TSA) Plus Cyanine 3 System kit (PerkinElmer, Waltham, Massachusetts, USA) as described previously (Tulke et al. ...
-
bioRxiv - Immunology 2021Quote: ... plasma solution at a rate of 0.18 ml/h for 90 min in parallel with a primed-continuous tracer D-[3-3H]-Glucose infusion (PerkinElmer, Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... [14C]-tetraethylammonium specific activity= 3.5 mCi/mmol) and [3H]-estrone 3-sulfate specific activity= 49.19 Ci/mmol) were purchased from Perkin Elmer. [3H]-phenylalanine (specific activity= 100 Ci/mmol) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were then rinsed in TBST 3 times and treated with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA). Membranes were exposed to GE Healthcare Hyperfilm ECL (28906839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dehydrated coverslips were overlaid with 0.3 μg/ml TAMRA–OO-(CCCTAA)3 or 0.3 μg/mL Alexa 488–OO-(CCCTAA)3 telomeric PNA probe (Panagene) in PNA hybridization solution (70% deionized formamide, 0.25% (v/v) NEN blocking reagent (PerkinElmer), 10 mM Tris–HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... whole blood activity and plasma activity after centrifugation were measured in a gamma-counter (Wizard2, 3”; Perkin Elmer, USA). The whole blood curve was linearly interpolated and resampled to match the time points of the reconstructed fPET frames ...
-
bioRxiv - Plant Biology 2024Quote: ... and the reactions were initiated by the addition of 3 μL of 52.6 mCi/mmol S-[methyl-14C]adenosyl-L-methionine (PerkinElmer). The reaction was overlaid with 1 mL of pentane and incubated 37°C for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: Huh-7 and Calu-3 cells were seeded in 96-well plate 96-CellCarrierUltra plates (Perkin Elmer, Hamburg, Germany), treated with ARN726 30 μM or GW6471 1μM and infected with SARS-CoV-2 1 MOI and 0.1 MOI respectively ...
-
bioRxiv - Molecular Biology 2024Quote: Mice were deprived of food for 3 h before intravenous injection of L-[4,5-3H(N)]leucine (NET1166, PerkinElmer) at a dose of 1 μCi/g ...
-
bioRxiv - Microbiology 2024Quote: ... Zn2+ and Mn2+ amounts were calculated from standard curves made with Pure Plus Multi-Element Calibration Standard 3 (0.5-100ppb, PerkinElmer). Metals amounts detected in the 30% HNO3 blank were subtracted from all samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissues and serum were placed into a Wizard 2 gamma counter (Perkin Elmer), and the levels of radioactivity were measured ...
-
bioRxiv - Immunology 2022Quote: ... or 2 µCi/mL (66.67 nM final concentration) [9,10-3H]palmitate (Perkin Elmer) for assessment of glycolytic or FAO flux ...
-
bioRxiv - Cancer Biology 2022Quote: ... at 2×104 cells/well into a CellCarrier-384 Ultra Microplate (Perkin Elmer). Cells were incubated at 37 °C in a humidified atmosphere and 10 % CO2 for 3 days.
-
bioRxiv - Neuroscience 2020Quote: ... and developed for 2 minutes using Tyramide Signal Amplification (TSA Plus kit, PerkinElmer). We stained for emphTg(isl1:GFP ...
-
bioRxiv - Neuroscience 2021Quote: ... Each mouse received 2 nmol of MMPSense 680 (150 μl; Perkin Elmer, France) or Cat K 680 FAST™ (100 μl ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to the wells before addition of 2-[3H]deoxyglucose (2DG) (PerkinElmer). During the final 5 min 2DG (0.25 μCi ...
-
bioRxiv - Cancer Biology 2020Quote: ... and imaged/analysed using the Vectra 2 System (PerkinElmer Inc., Waltham, MA, USA). The RAD51 Vectra score (RAD51Vs ...
-
bioRxiv - Neuroscience 2021Quote: ... and HPLC fractions were counted with automatic gamma well-counter (Wizard 2, PerkinElmer). The sample recovery rate ...
-
bioRxiv - Bioengineering 2022Quote: ... Activity in all samples was assessed via gamma counter (Wizard 2, Perkin Elmer) once decayed to a linear range ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 mM EDTA and 2-[125I]-MLT as radioligand (PerkinElmer, Waltham, MA, USA), using membranes extracted from HEK293 cells stably expressing human MT1 or MT2 receptors ...
-
bioRxiv - Plant Biology 2023Quote: ... and 750 nm using a spectrophotometer (Perkin Elmer UV/VIS spectrometer Lambda 2). The pigment contents were calculated according to the equation given by Wellburn ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human IL-2 concentration was measured with the AlphaLISA human IL2 Kit (PerkinElmer) and data collected on an Envision Plate Reader (PerkinElmer) ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then read in a Wallac Victor 2 fluorimeter (Perkin Elmer) with excitation at 355 nm ...
-
bioRxiv - Cancer Biology 2023Quote: ... blots were developed in 2 mL Western Lighting Plus chemiluminescent substrate (Perkin Elmer) and imaged on the ImageQuant LAS4000 (Cytiva).
-
bioRxiv - Cell Biology 2023Quote: ... Luminescence signal was read by Wallac 1420 Victor 2 (Perkin Elmer, Waltham, MA) or Synergy h1 microplate reader (BioTek ...
-
bioRxiv - Biochemistry 2024Quote: ... [1-3H] RuBP was synthetized enzymatically from D-[2-3H] glucose (PerkinElmer, MA) following published protocols47 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and D-[14C(U)] glucose (2 µCi/mL; Perkin Elmer, Cat: #NEC042V250UC, US) were diluted in DPBS supplemented with 10 mM HEPES (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Neuroscience 2021Quote: ... The signal of CB1 receptor hybridization was revealed by a TSA reaction using cyanine 3 (Cy3)-labeled tyramide (1:100 for 10 minutes, NEL744001KT PerkinElmer). After several washes ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2022Quote: ... 48 hpi liver-stage cultures were washed with PBS and lysed in Nano-Glo Luciferase Assay buffer containing Nano-Glo Luciferase Assay substrate diluted 1:200 and luminescence was measured after 3 minutes on an IVIS Specturum CT (PerkinElmer). To monitor merosome detachment at 65 hpi ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...