Labshake search
Citations for PerkinElmer :
351 - 400 of 512 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: Autophosphorylation of YegI and point mutants was performed by addition of 5 μCi of [γ-32P] ATP (Perkin Elmer) to 0.2 μM of purified YegI or YegI point mutants in 10 μl of reaction buffer containing 50 mM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and maintained in 2.5 mL of KSFM supplemented with 5% (v/v) charcoal-stripped FBS and 50 nM R1881 (PerkinElmer) 25 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 the luciferase activity was measured on Centro LB 960 Microplate Luminometer (Berthold Technologies) using Britelite PlusTM (PerkinElmer) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... oligonucleotides were 5’-end-labelled with [γ-32P]-ATP (10 mCi ml-1, 3000 Ci mmol-1, Perkin Elmer) with polynucleotide kinase (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... were collected from the CA1 SR from ≥5-7 sections per slice and processed for iterative deconvolution (99% confidence; Volocity 4.0, PerkinElmer). Three dimensional (3-D ...
-
bioRxiv - Biochemistry 2024Quote: ... The dry filter papers were placed in scintillation vials with 5 ml Ultima Gold F scintillation cocktail (Perkin Elmer) and scintillation was measured in a TriCarb 2900TR liquid scintillation analyzer (Perkin Elmer).
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 24-well plates for 2 h with 0.25 ml/well of fresh growth medium containing 5 μCi/ml [3H]adenine (PerkinElmer). The medium was then replaced with 0.5 ml/well of DMEM containing 20 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: ... with a total length of 109 ntb was prepared by 5′-end-labelling using [γ-32P]- ATP (Perkin Elmer) and T4 polynucleotide kinase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified RNA oligos were either phosphorylated with unlabeled ATP or 5’ end-labeled using [γ-32P] ATP (Perkin Elmer) and T4-Polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... The metabolite extract was transferred into scintillation vials with 5 mL Insta-Gel Plus scintillation cocktail (Perkin Elmer #601339).
-
bioRxiv - Neuroscience 2024Quote: ... we administered four intraperitoneal injections of 3H-Thy at 2 hrs intervals to adult mice (1.67 μL/g body weight, specific activity 5 Ci/mmol; PerkinElmer) with subsequent perfusion 2 hrs after the last injection (n = 3) ...
-
bioRxiv - Microbiology 2024Quote: Overnight cultures were diluted to an OD600 of ∼0.05 in 10 mL LB Miller broth supplemented with 5 µCi/mL 32P ortho-phosphoric acid (PerkinElmer) and grown until reaching an OD600 of ∼0.6 ...
-
bioRxiv - Neuroscience 2024Quote: HB(T)MVECs were incubated for 6 hours in EGM-2 containing 0.4 μCi/ml [5-3H]-D-glucose (PerkinElmer). Supernatant was transferred into glass vials containing perchloric acid and sealed with rubber stoppers ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... where reactions were incubated with 150 nM of the gel-filtration purified WT mouse Naa10 or Naa12 in a 30 µl reaction volume containing each 250 µM substrate peptide and radiolabeled [14C]acetyl-CoA (4 mCi/mmol; PerkinElmer Life Sciences) for 12 min (Naa12 ...
-
bioRxiv - Biophysics 2021Quote: ... 50 nM SpNatC (WT or mutants) was mixed with 50 μM Ac-CoA (14C-labeled, 4 mCi mmol-1; PerkinElmer Life Sciences) and varying peptide concentrations (ranging from 1.95 μM to 500 μM ...
-
bioRxiv - Bioengineering 2022Quote: ... Animals were kept under anesthesia (3-4%) following CHP injection and an initial image acquisition was performed using an IVIS Spectrum imaging system (PerkinElmer, Waltham, MA) <15 minutes following injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Half of the cell Triton X lysate from each well was pipetted into a scintillation vial and 4 ml of scintillation fluid (#6013329, Ultima GoldTM, Perkin Elmer, USA) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... were prepared in in vitro transcription reaction on linear PCR-generated template containing RNAImod (4) with 500 μM ATP or NAD and 25 μM [α 32P] CTP (Perkin Elmer) using hexa-histidine tagged E ...
-
bioRxiv - Microbiology 2024Quote: ... Mixtures were incubated for 60 min at room temperature prior to adding 4 µl of D-luciferin (30 mg/ml) (Perkin Elmer; #122799). After additional incubation for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: In vitro methyltransferase assays were performed using 30 ul reaction buffer (50 mM Tris-HCl pH 7.8, 50 mM KCl, 5 mM MgCl2) with 1 ul 3H-AdoMet (Perkin Elmer, specifific activity = 55-85 Ci/mMole,0.55 μCi/ul ...
-
bioRxiv - Cell Biology 2020Quote: ... and labeled for 5 min with with 1 μL per OD of cells of EXPRESS 35S Protein Labeling Mix (PerkinElmer) for 5 or 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... the plates containing infected macrophages were incubated at 37°C with 5% CO2 for 18 h in an Operetta High-Content Imaging System (PerkinElmer). During this 18 h incubation ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were incubated for 5 minutes at 37°C with 55µCi/well of 35S-L-methionine and 35S-L-cysteine Promix (Perkin Elmer) in a minimal volume of culture medium ...
-
bioRxiv - Cell Biology 2022Quote: ... cell motility was acquired using temperature (37°C) and CO2 (5%) controlled Operetta CLS High-Content Analysis System (PerkinElmer, HH16000000) (non-confocal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Spectra were analysed using OPUS 6.5 software (Bruker) and compared with RMIT University’s spectral library of organic compounds generated using Spectrum 10 software (Perkin Elmer). Fingerprint spectra shown in Figure 4D were prepared using GraphPad Prism.
-
bioRxiv - Microbiology 2021Quote: ... 1.37 μg/mL of RBD and 5 μg/mL of Ecto) and incubated overnight in protein-binding 96-well plates (PerkinElmer). The next day ...
-
bioRxiv - Neuroscience 2021Quote: ... plates were centrifuged once more under same conditions mentioned above and 5 µL of each FRET antibody pair was added (2.5 nM final concentration for donor and 5 nM for acceptor, diluted in 1x Lance buffer, (Perkin Elmer)) ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
bioRxiv - Biochemistry 2021Quote: ... microsomes prepared from HEK293 cells expressing RyR2 were incubated for 1 h at 25 °C with 5 nM [3H]ryanodine (PerkinElmer) in reaction media containing 0.17 M NaCl ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...