Labshake search
Citations for PerkinElmer :
301 - 350 of 915 citations for 7 Benzofuranol 5 amino 2 3 dihydro 2 2 dimethyl acetate ester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the same cell samples were further lysed and digested with 2% HNO3 for intracellular iron content quantification using an ICP-AES instrument (Perkin Elmer Optima 8000).
-
bioRxiv - Cancer Biology 2023Quote: ... and the plate was incubated in the dark for 2 h and then read in an EnSpire Alpha multimode plate reader (PerkinElmer, Waltham, MA, USA).
-
bioRxiv - Immunology 2024Quote: ... After an additional 2 hours blood was collected and serum FITC-dextran levels were measured with a Victor V multiparameter plate reader (Perkin Elmer, Waltham, MA). Quantification of serum FITC-dextran levels was performed with the WorkOut 2.5 software by extrapolation against know concentrations of FITC-dextran standard.
-
bioRxiv - Neuroscience 2024Quote: ... were collected from the CA1 SR from ≥5-7 sections per slice and processed for iterative deconvolution (99% confidence; Volocity 4.0, PerkinElmer). Three dimensional (3-D ...
-
bioRxiv - Immunology 2024Quote: Bacterial burden in MRSA /ux-infected mouse ears was monitored every 24 h for 3 or 7 consecutive days using an In Vivo Imaging System (IVIS) Spectrum (Perkin Elmer). Bacterial burden was quantified as the bioluminescence (radiance ...
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Immunology 2021Quote: ... Plasma 2-[1-14C]-Deoxy-D-glucose radioactivity was directly measured in a liquid scintillation counter (Tri-Carb 2810 TR, Perkin Elmer, Waltham, MA, USA). Tissue lysates were processed through ion exchange chromatography columns (Bio Rad Laboratories Inc. ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 to 10 mg powder were mixed with 2 ml scintillation cocktail and counts per minute (cpm) recorded with a TRI-Carb 2810TR liquid scintillation analyzer (Perkin Elmer, Waltham, MA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... Plates were incubated at room temperature for 2 h before measurement of the fluorescence using an EnVision Multimode Plate (Reader PerkinElmer Life and Analytical Sciences). All values were converted to cAMP concentration using cAMP standard curve performed parallel and data were subsequently normalized to the response of 100 μM forskolin in each cell line ...
-
bioRxiv - Bioengineering 2023Quote: ... for SARS-CoV-2 S protein neutralization antibody titer in the wells was observed using the High Content Analysis System (Perkin Elmer, Waltham, MA, USA) or microscope ...
-
bioRxiv - Genomics 2023Quote: ... was measured in triplicate and averaged at 405 nm for 45-60 minutes at 25°C on a Wallac Victor 2 1420 Multilabel Counter Plate Reader (Perkin Elmer, Waltham, MA, USA). Citrate synthase activity was standardized against the protein concentration of each sample using the Bovine Serum Albumin Assay (500-0201 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was then extracted from 2 ug of total RNA per sample using NEXTFLEX® Poly(A) Beads 2.0 (Perkin Elmer, Austin, Texas, USA). Libraries were prepared from mRNA samples using NEXTFLEX® Rapid Directional RNA-seq Kit 2.0 (Perkin Elmer ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Systems Biology 2023Quote: ... Free amino acids were determined with the EZ:FAAST amino acid analysis kit of Phenomenex on a GC-FID (Perkin Elmer) according to supplier instructions ...
-
bioRxiv - Genomics 2022Quote: SARS-CoV-2 genome libraries were constructed by using the NEXTFLEX® Variant-Seq™ SARS-CoV-2 kit with the automated high-throughput liquid handler Sciclone® G3 NGS (Perkin Elmer, USA) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... and SYBR Gold to the specified dye concentrations (0.03 to 60 μM) and analyzed the sample in a 10 × 2 mm2 cuvette (Perkin Elmer UV/VIS Spectroscopy Cell B0631122) for 5 min for each condition ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Animals were injected intravenously 24h after the last pharmacological treatment with Hypoxisense 680 (2 nmol/100 uL per mouse, Perkin Elmer, Life Sciences, Zaventem, Belgium), and the Hypoxisense 680 was measured in vivo 24h post-injection using the IVIS Spectrum (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... and immediately exposed to 2μCi/mL 14C-acetate (Perkin Elmer). After incubation at 37°C for 20 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2021Quote: ... Thirty μL of tissue homogenate supernatant were mixed with 370 μL of the oxidation reaction mixture containing 7% BSA/5 mM palmitate/0.01 μCi/μL 14C-palmitate (PerkinElmer, Waltham, MA) and incubated at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 10% BSA and 3 µl [35S] EasyTag Express protein labelling mix (7 mCi, 259 MBq, 1175 Ci/mmol in 632 ml; Perkin Elmer, Espoo, Finland). After 2 h of incubation at 37 °C cells were washed twice with PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Opal 7 manual kit (PerkinElmer) was used according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... 3H-labeled acetate and 3H-labeled oleate were acquired from PerkinElmer. All chemicals (analytical grade ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 nmol (10 µCi) □1-14C] acetate (Perkin Elmer Life Sciences) were added to each vial and the reaction was stopped after 4 h with 2 ml preheated isopropanol followed by 20 min incubation at 70°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Bioluminescence imaging was performed at days 5 and 7 post engraftment using an IVIS Lumina III in vivo imaging system (Perkin Elmer, Waltham, MA). IVIS instrument exposure time was 3 seconds ...
-
bioRxiv - Systems Biology 2020Quote: ... Cy5-TSA (7 min; Perkin Elmer NEL745E001KT).
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Microbiology 2021Quote: ... The 14C-labeled amino acid of interest (Perkin Elmer, MA, USA) was added to the cells to a final concentration of 1 µM with stirring ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μM [3H]-amino acid (Perkin Elmer, 7.5 Ci/mmol) in a buffer containing 20 mM KCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and 7 μCi [35S]-Methionine/cysteine (PerkinElmer; NEG072007MC) and labelled for 2 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... and the uptake reactions were started by adding radiolabeled amino acid (PerkinElmer). For the uptake assays by PUT4 variants ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 293FT (1.5 × 104) cells expressing DSP1–7 (293FT/DSP1–7) were plated in 96-well plates (Perkin Elmer Life Sciences, Waltham, MA, USA) with DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2020Quote: ... Emission signal was collected using a liquid crystal tunable filter (LCTF) (VariSpec VIS-7-35, PerkinElmer, Inc. Waltham, MA, USA, 7 nm bandwidth) programmed to collect at 515 nm and a high-resolution dual-modal charge-coupled device (CCD ...
-
bioRxiv - Cancer Biology 2023Quote: ... target cells were loaded with an acetoxymethyl ester of the fluorescence-enhancing ligand (BATDA; Perkin Elmer #C136-100) and then co-cultured at 10,000 cells/well in triplicate with effector cells at the indicated E:T ratios ...
-
bioRxiv - Molecular Biology 2022Quote: ... 7 mCi of γ-32P-ATP (PerkinElmer, 3000 Ci/mmol), and either DMSO or 2 μM of the Cdk4/6-inhibitor Palbociclib (Selleckchem ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Plant Biology 2021Quote: ... 10 µM cycloheximide and 10 µCi ml-1 Na-14C acetate (PerkinElmer: 56.6 mCi mM-1) were then added to the culture ...
-
bioRxiv - Physiology 2021Quote: ... acylcarnitines were derivatized to their butyl esters and treated with the reagents of the NeoGram MSMS-AAAC kit (PerkinElmer). Their analysis was carried out on a Waters 2795/Quattro Micro AP liquid chromatography–tandem mass spectrometer (Waters ...